Transcript: Human XM_024449194.1

PREDICTED: Homo sapiens coiled-coil domain containing 92 (CCDC92), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC92 (80212)
Length:
2108
CDS:
464..1459

Additional Resources:

NCBI RefSeq record:
XM_024449194.1
NBCI Gene record:
CCDC92 (80212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133731 CGTGTATCTCAAGGAACTAAA pLKO.1 1977 3UTR 100% 13.200 18.480 N CCDC92 n/a
2 TRCN0000330949 GCAGCACTGCACAGATTTAAC pLKO_005 631 CDS 100% 13.200 9.240 N CCDC92 n/a
3 TRCN0000138577 CCACACAGTCACACACCTAAT pLKO.1 1774 3UTR 100% 10.800 7.560 N CCDC92 n/a
4 TRCN0000353704 CCACACAGTCACACACCTAAT pLKO_005 1774 3UTR 100% 10.800 7.560 N CCDC92 n/a
5 TRCN0000330876 TTTGAAGAGGTCTACAGATTC pLKO_005 1115 CDS 100% 10.800 7.560 N CCDC92 n/a
6 TRCN0000137451 GCGTGTATCTCAAGGAACTAA pLKO.1 1976 3UTR 100% 5.625 3.938 N CCDC92 n/a
7 TRCN0000134827 CCAACTGAAAGTGAAAGAGAA pLKO.1 742 CDS 100% 4.950 3.465 N CCDC92 n/a
8 TRCN0000138505 CAGAAGAACCTCCTGTTCCTT pLKO.1 554 CDS 100% 3.000 2.100 N CCDC92 n/a
9 TRCN0000134049 CTGAAAGTGAAAGAGAACGAA pLKO.1 746 CDS 100% 3.000 2.100 N CCDC92 n/a
10 TRCN0000353777 ACAGGAGACGGGACTTCTAAA pLKO_005 683 CDS 100% 13.200 7.920 N CCDC92 n/a
11 TRCN0000138578 CAGAGAGCAGGAAACTCCTTT pLKO.1 1140 CDS 100% 4.950 2.970 N CCDC92 n/a
12 TRCN0000330875 CAGAGAGCAGGAAACTCCTTT pLKO_005 1140 CDS 100% 4.950 2.970 N CCDC92 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449194.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04190 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04190 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471853 ACACTAAGATACTGTAGAAAGGCC pLX_317 34.6% 100% 100% V5 n/a
Download CSV