Transcript: Human XM_024449229.1

PREDICTED: Homo sapiens family with sequence similarity 222 member A (FAM222A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM222A (84915)
Length:
3561
CDS:
1084..2340

Additional Resources:

NCBI RefSeq record:
XM_024449229.1
NBCI Gene record:
FAM222A (84915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282773 CGCCTACCCGTCTACAGATAA pLKO_005 2320 CDS 100% 13.200 18.480 N FAM222A n/a
2 TRCN0000263705 TCACCGTAGGCCAGTACTTTG pLKO_005 1997 CDS 100% 10.800 15.120 N FAM222A n/a
3 TRCN0000263706 CAAACCCTGGACTACCATATT pLKO_005 2974 3UTR 100% 13.200 10.560 N FAM222A n/a
4 TRCN0000263704 GCAGTCACTGGAGTATCTCAT pLKO_005 2199 CDS 100% 4.950 3.465 N FAM222A n/a
5 TRCN0000216884 GAGTATCTCATCAACGACATC pLKO.1 2209 CDS 100% 4.050 2.835 N Fam222a n/a
6 TRCN0000282772 CCGCTGTCCATCAAGATCTTC pLKO_005 1150 CDS 100% 4.950 2.970 N FAM222A n/a
7 TRCN0000172488 CAGGTGAAGACCACTCTGATA pLKO.1 2859 3UTR 100% 4.950 2.970 N FAM222A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09239 pDONR223 100% 92.4% 92.4% None 0_1ins102;432C>A n/a
2 ccsbBroad304_09239 pLX_304 0% 92.4% 92.4% V5 0_1ins102;432C>A n/a
3 TRCN0000477989 AACAGTACCCACGGACTGATAAAA pLX_317 27.3% 92.4% 92.4% V5 0_1ins102;432C>A n/a
Download CSV