Transcript: Human XM_024449316.1

PREDICTED: Homo sapiens WD repeat and FYVE domain containing 2 (WDFY2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDFY2 (115825)
Length:
14451
CDS:
6417..7421

Additional Resources:

NCBI RefSeq record:
XM_024449316.1
NBCI Gene record:
WDFY2 (115825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423311 TGCACAGCACACGCGACAATT pLKO_005 6968 CDS 100% 13.200 10.560 N WDFY2 n/a
2 TRCN0000156031 CCATAGGTCTAGACAATGGTA pLKO.1 6469 CDS 100% 3.000 2.400 N WDFY2 n/a
3 TRCN0000417159 TGGAACTGACAAGGTTATTAA pLKO_005 7370 CDS 100% 15.000 10.500 N WDFY2 n/a
4 TRCN0000414082 GGAATCAGAAAGATAGTATTT pLKO_005 7433 3UTR 100% 13.200 9.240 N WDFY2 n/a
5 TRCN0000216850 GGTCTAGACAATGGTACAATC pLKO.1 6474 CDS 100% 10.800 7.560 N Wdfy2 n/a
6 TRCN0000242080 GGTCTAGACAATGGTACAATC pLKO_005 6474 CDS 100% 10.800 7.560 N Wdfy2 n/a
7 TRCN0000156182 CAAGCAAATGTGGGACAGTAA pLKO.1 7112 CDS 100% 4.950 3.465 N WDFY2 n/a
8 TRCN0000158413 CCAGAGGATGGTTACTGACTT pLKO.1 7348 CDS 100% 4.950 3.465 N WDFY2 n/a
9 TRCN0000157818 CCAGAGTGGTAAAGCAGACAT pLKO.1 7488 3UTR 100% 4.950 3.465 N WDFY2 n/a
10 TRCN0000156445 CAGAGTGACGATGATCCTGTT pLKO.1 6563 CDS 100% 4.050 2.835 N WDFY2 n/a
11 TRCN0000156358 CTCTGTCATCATGTGGGACAT pLKO.1 6881 CDS 100% 4.050 2.835 N WDFY2 n/a
12 TRCN0000156841 GCCATCACAGATGAAGAACGT pLKO.1 7266 CDS 100% 2.640 1.848 N WDFY2 n/a
13 TRCN0000157558 GAGGCCATCACAGATGAAGAA pLKO.1 7263 CDS 100% 4.950 2.970 N WDFY2 n/a
14 TRCN0000179847 CTTCTGGAACTGACAAGGTAA pLKO.1 7366 CDS 100% 4.950 2.970 N Wdfy2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04688 pDONR223 100% 83.5% 83.5% None 0_1ins198 n/a
2 ccsbBroad304_04688 pLX_304 0% 83.5% 83.5% V5 0_1ins198 n/a
3 TRCN0000474486 ACCACCACCCACTCCAGAACCCGG pLX_317 30.7% 83.5% 83.5% V5 0_1ins198 n/a
Download CSV