Transcript: Human XM_024449444.1

PREDICTED: Homo sapiens mitochondrial translation release factor 1 (MTRF1), transcript variant X40, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTRF1 (9617)
Length:
1850
CDS:
993..1766

Additional Resources:

NCBI RefSeq record:
XM_024449444.1
NBCI Gene record:
MTRF1 (9617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232959 GATTTGCGAATAGATACATTT pLKO_005 1714 CDS 100% 13.200 18.480 N MTRF1 n/a
2 TRCN0000232958 CAGAATTATTCGTGCTATAAA pLKO_005 1626 CDS 100% 15.000 10.500 N MTRF1 n/a
3 TRCN0000232957 CCAACAATTTACCCGAGAAAT pLKO_005 1592 CDS 100% 13.200 9.240 N MTRF1 n/a
4 TRCN0000152306 CCAACAAGAAAGATCACAGAT pLKO.1 1824 3UTR 100% 4.950 3.465 N MTRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11394 pDONR223 100% 56% 54% None (many diffs) n/a
2 ccsbBroad304_11394 pLX_304 0% 56% 54% V5 (many diffs) n/a
3 TRCN0000480237 GAGAGCAACCATCCTGTAATGGCC pLX_317 76.7% 56% 54% V5 (many diffs) n/a
Download CSV