Transcript: Human XM_024449525.1

PREDICTED: Homo sapiens coiled-coil domain containing 197 (CCDC197), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC197 (256369)
Length:
1625
CDS:
105..923

Additional Resources:

NCBI RefSeq record:
XM_024449525.1
NBCI Gene record:
CCDC197 (256369)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449525.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163935 GCTCGATCTGATTAAGGAGTT pLKO.1 704 CDS 100% 4.050 5.670 N CCDC197 n/a
2 TRCN0000162286 CGATCTGATTAAGGAGTTCAT pLKO.1 707 CDS 100% 4.950 3.960 N CCDC197 n/a
3 TRCN0000164221 CAGAAGAAGCTCAAGAGAGAA pLKO.1 210 CDS 100% 4.950 3.465 N CCDC197 n/a
4 TRCN0000163403 GCAAATGACCATCACCAACAT pLKO.1 623 CDS 100% 4.950 3.465 N CCDC197 n/a
5 TRCN0000166105 GAGAGAAGTCGAGAAGCACAA pLKO.1 224 CDS 100% 4.050 2.835 N CCDC197 n/a
6 TRCN0000165048 GCACAGCATCACTTACCAGAA pLKO.1 542 CDS 100% 4.050 2.835 N CCDC197 n/a
7 TRCN0000165962 GAAGTCGAGAAGCACAAGCTT pLKO.1 228 CDS 100% 3.000 2.100 N CCDC197 n/a
8 TRCN0000166401 CGGCTACATGCAAATGACCAT pLKO.1 614 CDS 100% 2.640 1.848 N CCDC197 n/a
9 TRCN0000160863 GACTATCTGATTAAGGTCCTT pLKO.1 255 CDS 100% 2.640 1.848 N CCDC197 n/a
10 TRCN0000165831 GCAGAAGAAGCTCAAGAGAGA pLKO.1 209 CDS 100% 2.640 1.848 N CCDC197 n/a
11 TRCN0000163827 CATCACTTACCAGAAGGACAT pLKO.1 548 CDS 100% 4.050 2.430 N CCDC197 n/a
12 TRCN0000166104 GCTCAAGAGAGAAGTCGAGAA pLKO.1 218 CDS 100% 4.050 2.430 N CCDC197 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449525.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10333 pDONR223 100% 51.4% 43.9% None 1_9delATGGCAGCC;363_366delGTTG;434_816del n/a
2 ccsbBroad304_10333 pLX_304 0% 51.4% 43.9% V5 1_9delATGGCAGCC;363_366delGTTG;434_816del n/a
3 TRCN0000474908 TTTCAGCAGGACCAGTTGAATTTA pLX_317 100% 51.4% 43.9% V5 1_9delATGGCAGCC;363_366delGTTG;434_816del n/a
Download CSV