Transcript: Human XM_024449826.1

PREDICTED: Homo sapiens tryptophanyl tRNA synthetase 2, mitochondrial (WARS2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WARS2 (10352)
Length:
3294
CDS:
586..1599

Additional Resources:

NCBI RefSeq record:
XM_024449826.1
NBCI Gene record:
WARS2 (10352)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449826.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045579 GTGAGGTTACAGGATGAATAT pLKO.1 694 CDS 100% 13.200 18.480 N WARS2 n/a
2 TRCN0000311704 GTGAGGTTACAGGATGAATAT pLKO_005 694 CDS 100% 13.200 18.480 N WARS2 n/a
3 TRCN0000045578 CCTCGATTACAACATTTACAT pLKO.1 916 CDS 100% 5.625 7.875 N WARS2 n/a
4 TRCN0000311705 CCTCGATTACAACATTTACAT pLKO_005 916 CDS 100% 5.625 7.875 N WARS2 n/a
5 TRCN0000045581 CGAGTCCATTCTCACATCCAT pLKO.1 1137 CDS 100% 3.000 2.400 N WARS2 n/a
6 TRCN0000311629 CGAGTCCATTCTCACATCCAT pLKO_005 1137 CDS 100% 3.000 2.400 N WARS2 n/a
7 TRCN0000045580 CAGAGGAGATAGTGCAGAAAT pLKO.1 1247 CDS 100% 13.200 9.240 N WARS2 n/a
8 TRCN0000311630 CAGAGGAGATAGTGCAGAAAT pLKO_005 1247 CDS 100% 13.200 9.240 N WARS2 n/a
9 TRCN0000045582 GACAGCAAGAAGCGAGTATTT pLKO.1 610 CDS 100% 13.200 9.240 N WARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449826.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07590 pDONR223 100% 92.5% 91.3% None (many diffs) n/a
2 ccsbBroad304_07590 pLX_304 0% 92.5% 91.3% V5 (many diffs) n/a
3 TRCN0000466879 CTTATAACGTTATGAAACTCGTCA pLX_317 39.3% 92.5% 91.3% V5 (many diffs) n/a
Download CSV