Transcript: Human XM_024449856.1

PREDICTED: Homo sapiens TBC1 domain family member 21 (TBC1D21), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D21 (161514)
Length:
3435
CDS:
239..1027

Additional Resources:

NCBI RefSeq record:
XM_024449856.1
NBCI Gene record:
TBC1D21 (161514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150365 CAATAACATTGCACGTGACAT pLKO.1 298 CDS 100% 4.950 6.930 N TBC1D21 n/a
2 TRCN0000428487 CTACAAGGCCTTATGCCAAAT pLKO_005 220 5UTR 100% 10.800 8.640 N TBC1D21 n/a
3 TRCN0000152496 CTTCACAGAGACTCGCAATAA pLKO.1 283 CDS 100% 13.200 9.240 N TBC1D21 n/a
4 TRCN0000157377 CGTGTTTGCTGAGCACCTAAA pLKO.1 598 CDS 100% 10.800 7.560 N TBC1D21 n/a
5 TRCN0000157431 GCCTTCAAGTCCTTCGATGAT pLKO.1 680 CDS 100% 4.950 3.465 N TBC1D21 n/a
6 TRCN0000152734 CCATGAGATGATGATGCTCTT pLKO.1 436 CDS 100% 4.050 2.835 N TBC1D21 n/a
7 TRCN0000156340 CCAAGAACCTAGACATGCTCA pLKO.1 552 CDS 100% 2.640 1.848 N TBC1D21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05111 pDONR223 100% 64.9% 64.8% None (many diffs) n/a
2 ccsbBroad304_05111 pLX_304 0% 64.9% 64.8% V5 (many diffs) n/a
3 TRCN0000476155 AAACCCATGAGCAGATGGACCGCA pLX_317 34.7% 64.9% 64.8% V5 (many diffs) n/a
Download CSV