Transcript: Human XM_024449896.1

PREDICTED: Homo sapiens SIN3 transcription regulator family member A (SIN3A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIN3A (25942)
Length:
6618
CDS:
197..4018

Additional Resources:

NCBI RefSeq record:
XM_024449896.1
NBCI Gene record:
SIN3A (25942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229296 GGTGGAACAGAATCGTTATTT pLKO_005 1574 CDS 100% 15.000 21.000 N SIN3A n/a
2 TRCN0000021778 CGTGTCAAATACGGCACAGTA pLKO.1 3983 CDS 100% 4.950 6.930 N SIN3A n/a
3 TRCN0000229298 GATCAAATCAGAGGACTATAT pLKO_005 3733 CDS 100% 13.200 10.560 N SIN3A n/a
4 TRCN0000021775 CCCTGAGTTGTTTAATTGGTT pLKO.1 1729 CDS 100% 3.000 2.400 N SIN3A n/a
5 TRCN0000219027 AGACTGGAGAAGGACTTAATA pLKO_005 4413 3UTR 100% 15.000 10.500 N SIN3A n/a
6 TRCN0000229297 CTAGCACAGAAACCAGTATTT pLKO_005 3551 CDS 100% 13.200 9.240 N SIN3A n/a
7 TRCN0000039370 GCCTCAGGTCTACAATGATTT pLKO.1 616 CDS 100% 13.200 9.240 N Sin3a n/a
8 TRCN0000218101 TGCTTTGATGTGCTAGCATAA pLKO_005 4847 3UTR 100% 10.800 7.560 N SIN3A n/a
9 TRCN0000021777 CCGCTATAGCAGCAGTTCATA pLKO.1 423 CDS 100% 5.625 3.938 N SIN3A n/a
10 TRCN0000021774 CGTGAACATCTAGCACAGAAA pLKO.1 3542 CDS 100% 4.950 3.465 N SIN3A n/a
11 TRCN0000021776 GCTACGTCTCAAAGAACCTAT pLKO.1 3028 CDS 100% 4.950 3.465 N SIN3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11788 pDONR223 100% 11.7% 10% None (many diffs) n/a
2 ccsbBroad304_11788 pLX_304 0% 11.7% 10% V5 (many diffs) n/a
3 TRCN0000480239 GTACGATTCAGAACATCATTATTA pLX_317 75% 11.7% 10% V5 (many diffs) n/a
Download CSV