Transcript: Human XM_024450004.1

PREDICTED: Homo sapiens immunoglobulin superfamily containing leucine rich repeat 2 (ISLR2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ISLR2 (57611)
Length:
2971
CDS:
447..2684

Additional Resources:

NCBI RefSeq record:
XM_024450004.1
NBCI Gene record:
ISLR2 (57611)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427694 TATTAGGGAGTGGGCCGATTT pLKO_005 2835 3UTR 100% 10.800 15.120 N ISLR2 n/a
2 TRCN0000146567 CACAACTTCATATCCAGCTTT pLKO.1 768 CDS 100% 4.950 6.930 N ISLR2 n/a
3 TRCN0000181206 CGTTTCTAACCACGCGTTCAA pLKO.1 1847 CDS 100% 4.950 6.930 N ISLR2 n/a
4 TRCN0000414653 CTTAGTCTGTCCGCGAACAAG pLKO_005 612 CDS 100% 4.950 6.930 N ISLR2 n/a
5 TRCN0000179714 GCAACTCTATCACAATCCCTT pLKO.1 974 CDS 100% 2.640 3.696 N ISLR2 n/a
6 TRCN0000179978 CCAGGAGATTAATGGCAACTA pLKO.1 2645 CDS 100% 4.950 3.465 N ISLR2 n/a
7 TRCN0000150133 CCAAGCACAGTGTTTATCTTA pLKO.1 2914 3UTR 100% 5.625 3.375 N ISLR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03836 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03836 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477821 GCCTGAATCCTAGTTCCCCTCACC pLX_317 15.3% 100% 100% V5 n/a
Download CSV