Transcript: Human XM_024450251.1

PREDICTED: Homo sapiens haptoglobin-related protein (HPR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPR (3250)
Length:
1251
CDS:
22..1086

Additional Resources:

NCBI RefSeq record:
XM_024450251.1
NBCI Gene record:
HPR (3250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075183 GCTGACCAATACGATTGCATA pLKO.1 775 CDS 100% 4.950 6.930 N HPR n/a
2 TRCN0000075184 CCAATACGATTGCATAACGCA pLKO.1 780 CDS 100% 0.750 1.050 N HPR n/a
3 TRCN0000433980 CAAACAGAAGGTGCTTGTTAA pLKO_005 621 CDS 100% 13.200 9.240 N HPR n/a
4 TRCN0000075186 GCTGGGATCCTAAGCTTTGAT pLKO.1 979 CDS 100% 5.625 3.938 N HPR n/a
5 TRCN0000425141 CACTGTACTCAGGCAATGATG pLKO_005 95 CDS 100% 4.950 3.465 N HPR n/a
6 TRCN0000075187 CTGTGGCTGACCAATACGATT pLKO.1 770 CDS 100% 4.950 3.465 N HPR n/a
7 TRCN0000428698 GTGTCGGCATGTCTAAGTACC pLKO_005 884 CDS 100% 4.050 2.835 N HPR n/a
8 TRCN0000075185 CGGATATTTCAGATGACCGCT pLKO.1 119 CDS 100% 0.660 0.462 N HPR n/a
9 TRCN0000083016 CCAGTGTAAGAACTACTACAA pLKO.1 192 CDS 100% 4.950 2.475 Y HP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06397 pDONR223 100% 80% 76.5% None (many diffs) n/a
2 ccsbBroad304_06397 pLX_304 0% 80% 76.5% V5 (many diffs) n/a
3 TRCN0000469493 TTGTTTACTGACTTTAGCTCAGGC pLX_317 35.1% 80% 76.5% V5 (many diffs) n/a
Download CSV