Transcript: Human XM_024450311.1

PREDICTED: Homo sapiens RNA binding fox-1 homolog 1 (RBFOX1), transcript variant X32, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBFOX1 (54715)
Length:
4048
CDS:
177..1328

Additional Resources:

NCBI RefSeq record:
XM_024450311.1
NBCI Gene record:
RBFOX1 (54715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073260 CCGGACCTCAGACAAATGTTT pLKO.1 675 CDS 100% 5.625 7.875 N RBFOX1 n/a
2 TRCN0000336322 TTCATTGCAGGCTAGTATATA pLKO_005 1396 3UTR 100% 15.000 12.000 N Rbfox1 n/a
3 TRCN0000336324 CCATATCCAGAGTGCTATATT pLKO_005 1743 3UTR 100% 15.000 10.500 N Rbfox1 n/a
4 TRCN0000073258 CCGGCAGTATTCAGCTTCTTA pLKO.1 2118 3UTR 100% 5.625 3.938 N RBFOX1 n/a
5 TRCN0000097932 CCCAGACACAACCTTCTGAAA pLKO.1 589 CDS 100% 4.950 3.465 N Rbfox1 n/a
6 TRCN0000097933 GTGCAGACATTTATGGTGGTT pLKO.1 1120 CDS 100% 2.640 1.848 N Rbfox1 n/a
7 TRCN0000073259 CCCTTATACAAATGGCTGGAA pLKO.1 893 CDS 100% 2.640 1.584 N RBFOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450311.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03449 pDONR223 100% 82.9% 77% None (many diffs) n/a
2 ccsbBroad304_03449 pLX_304 0% 82.9% 77% V5 (many diffs) n/a
3 TRCN0000466913 CTCAGGTTCATGAAGTTACTCGTT pLX_317 21.6% 82.9% 77% V5 (many diffs) n/a
Download CSV