Construct: ORF TRCN0000466913
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008162.1_s317c1
- Derived from:
- ccsbBroadEn_03449
- DNA Barcode:
- CTCAGGTTCATGAAGTTACTCGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RBFOX1 (54715)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466913
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | NM_145893.3 | 100% | 100% | |
2 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_011522547.2 | 97.4% | 97.9% | (many diffs) |
3 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023332.1 | 93.2% | 89.9% | (many diffs) |
4 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | NM_145892.3 | 92.1% | 88% | 1055_1056ins53;1133_1176del |
5 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | NM_001364800.2 | 90.7% | 89.2% | (many diffs) |
6 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023336.1 | 90.7% | 89.2% | (many diffs) |
7 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_011522548.2 | 90.6% | 90.8% | (many diffs) |
8 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023328.2 | 89.4% | 82.1% | (many diffs) |
9 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023330.1 | 89.3% | 83.5% | (many diffs) |
10 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_005255387.4 | 88.9% | 88.9% | 1186_1332del |
11 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450315.1 | 87.3% | 87.8% | (many diffs) |
12 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023337.1 | 86.6% | 83% | (many diffs) |
13 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | NM_145891.3 | 86.6% | 83% | 1055_1056ins53;1133_1254del |
14 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_005255386.4 | 85.3% | 81.9% | (many diffs) |
15 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_011522546.2 | 84.3% | 81.2% | (many diffs) |
16 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023341.2 | 84% | 82.2% | (many diffs) |
17 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023342.1 | 84% | 82.2% | (many diffs) |
18 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023323.2 | 83.2% | 80.2% | (many diffs) |
19 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450309.1 | 83.1% | 75.7% | (many diffs) |
20 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_005255390.4 | 83% | 81.3% | (many diffs) |
21 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_005255391.4 | 83% | 81.3% | (many diffs) |
22 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450316.1 | 83% | 81.5% | (many diffs) |
23 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450311.1 | 82.9% | 77% | (many diffs) |
24 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023320.2 | 82.2% | 75.5% | (many diffs) |
25 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450310.1 | 82.1% | 75.1% | (many diffs) |
26 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023321.2 | 82.1% | 76.6% | (many diffs) |
27 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450312.1 | 82% | 76.3% | (many diffs) |
28 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450306.1 | 81.9% | 81.9% | 526_527ins93;1093_1239del |
29 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023326.2 | 80.9% | 79.5% | (many diffs) |
30 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023327.1 | 80.8% | 74.3% | (many diffs) |
31 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | NM_001308117.1 | 80.4% | 70.3% | (many diffs) |
32 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_005255394.4 | 80.4% | 76.6% | 736_737ins81;974_975ins53;1052_1173del |
33 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023322.2 | 80% | 75% | (many diffs) |
34 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023331.2 | 79.9% | 79.9% | 0_1ins120;1066_1212del |
35 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | NM_001142334.1 | 78.4% | 73.5% | (many diffs) |
36 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | NM_018723.4 | 78.4% | 73.5% | (many diffs) |
37 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023333.1 | 78.4% | 73.5% | (many diffs) |
38 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023324.2 | 77.8% | 68.3% | (many diffs) |
39 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450304.1 | 77.7% | 69.3% | (many diffs) |
40 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023334.1 | 74.7% | 68% | (many diffs) |
41 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450305.1 | 74.3% | 69.1% | (many diffs) |
42 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450307.1 | 74% | 72.6% | (many diffs) |
43 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450308.1 | 73.9% | 67.4% | (many diffs) |
44 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | NM_001142333.2 | 72.3% | 67.2% | (many diffs) |
45 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023338.1 | 72.3% | 67.2% | (many diffs) |
46 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023329.2 | 72% | 62.5% | (many diffs) |
47 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023340.1 | 71.4% | 66.5% | (many diffs) |
48 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450314.1 | 67.6% | 57.6% | (many diffs) |
49 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450313.1 | 65.1% | 56.8% | (many diffs) |
50 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_024450303.1 | 62.9% | 58.4% | (many diffs) |
51 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023318.2 | 61.6% | 57.2% | (many diffs) |
52 | human | 54715 | RBFOX1 | RNA binding fox-1 homolog 1 | XM_017023319.2 | 53.8% | 47.1% | (many diffs) |
53 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522189.3 | 91% | 97.4% | (many diffs) |
54 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245915.2 | 85.9% | 89.5% | (many diffs) |
55 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316997.1 | 85.7% | 89.5% | (many diffs) |
56 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245916.1 | 83.6% | 87.5% | (many diffs) |
57 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317002.1 | 83.6% | 87.5% | (many diffs) |
58 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522176.3 | 81% | 86.7% | (many diffs) |
59 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245918.2 | 80.1% | 66.8% | (many diffs) |
60 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317006.1 | 80% | 86% | (many diffs) |
61 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245917.2 | 79.8% | 66.5% | (many diffs) |
62 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316990.1 | 79.5% | 83.2% | (many diffs) |
63 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317005.1 | 79.5% | 83.2% | (many diffs) |
64 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | NM_183188.2 | 78.5% | 81% | (many diffs) |
65 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522175.3 | 78.5% | 81.5% | (many diffs) |
66 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245920.1 | 78.1% | 78.3% | (many diffs) |
67 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317007.1 | 78.1% | 78.3% | (many diffs) |
68 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522177.3 | 77.5% | 81.5% | (many diffs) |
69 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522181.3 | 76.8% | 81.3% | (many diffs) |
70 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316994.1 | 76.6% | 76.3% | (many diffs) |
71 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245914.2 | 76.6% | 76.4% | (many diffs) |
72 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522184.3 | 76.5% | 79.1% | (many diffs) |
73 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522155.3 | 76.4% | 79.7% | (many diffs) |
74 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522178.2 | 76.4% | 79.7% | (many diffs) |
75 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522179.2 | 76.4% | 79.7% | (many diffs) |
76 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245922.2 | 76.4% | 79.7% | (many diffs) |
77 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522173.3 | 76% | 75.2% | (many diffs) |
78 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316989.1 | 74.5% | 74.5% | (many diffs) |
79 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317000.1 | 74.5% | 74.5% | (many diffs) |
80 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245907.2 | 74.5% | 78% | (many diffs) |
81 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316991.1 | 74.5% | 78% | (many diffs) |
82 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316992.1 | 74.1% | 73.9% | (many diffs) |
83 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245910.2 | 73.9% | 74% | (many diffs) |
84 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522185.3 | 73.1% | 78.3% | (many diffs) |
85 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522186.3 | 73.1% | 78.3% | (many diffs) |
86 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245909.2 | 72.8% | 76% | (many diffs) |
87 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | NM_021477.5 | 72% | 72.2% | (many diffs) |
88 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522188.1 | 72% | 72.2% | (many diffs) |
89 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245911.2 | 72% | 72.2% | (many diffs) |
90 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316998.1 | 72% | 72.2% | (many diffs) |
91 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316996.1 | 71.2% | 76.5% | (many diffs) |
92 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317004.1 | 71% | 72.9% | (many diffs) |
93 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316993.1 | 70.7% | 73.7% | (many diffs) |
94 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245912.2 | 70.5% | 73.7% | (many diffs) |
95 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245913.2 | 69.5% | 69.7% | (many diffs) |
96 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316988.1 | 68.6% | 72% | (many diffs) |
97 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522192.3 | 68.6% | 70.7% | (many diffs) |
98 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_006522190.1 | 68.3% | 68.3% | (many diffs) |
99 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017316999.1 | 68.2% | 67.8% | (many diffs) |
100 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_011245919.1 | 66% | 66.1% | (many diffs) |
101 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317003.1 | 66% | 66.1% | (many diffs) |
102 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317008.1 | 31.3% | 19.5% | (many diffs) |
103 | mouse | 268859 | Rbfox1 | RNA binding protein, fox-1 ... | XM_017317009.1 | 31.3% | 19.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1254
- ORF length:
- 1185
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctggcgtct caaggagttc tcctgcatcc ttatggcgtg cctatgattg 121 taccggcagc tccttacctt cctggactga ttcagggtaa tcaggaagca gccgctgccc 181 ctgacacaat ggctcagcct tacgcttcgg cccagtttgc tcccccgcag aacggtatcc 241 ccgcggaata cacggcccct catccccacc ccgcgccaga gtacacaggc cagaccacgg 301 ttcccgagca cacattaaac ctgtaccctc ccgcccagac gcactccgag cagagcccgg 361 cggacacgag cgctcagacc gtctctggca ccgccacaca gacagatgac gcagcaccga 421 cggatggcca gccccagaca caaccttctg aaaacacgga aaacaagtct cagcccaagc 481 ggctgcatgt ctccaatatc cccttcaggt tccgggatcc ggacctcaga caaatgtttg 541 gtcaatttgg taaaatctta gatgttgaaa ttatttttaa tgagcgaggc tcaaagggat 601 ttggtttcgt aactttcgaa aatagtgccg atgcggacag ggcgagggag aaattacacg 661 gcaccgtggt agagggccgt aaaatcgagg taaataatgc cacagcacgt gtaatgacaa 721 ataaaaagac cgtcaaccct tatacaaatg gctggaaatt gaatccagtt gtgggtgcag 781 tctacagtcc cgaattctat gcaggcacgg tcctgttgtg ccaggccaac caggagggat 841 cttccatgta cagtgccccc agttcacttg tatatacttc tgcaatgcca ggcttcccgt 901 atccagcagc caccgccgcg gccgcctacc gaggggcgca cctgcgaggc cgcggtcgca 961 ccgtgtacaa caccttcagg gccgcggcgc ccccgccccc gaTCCCGGCC TACGGCGGAG 1021 TAGTGTATCA AGAGCCTGTG TATGGCAATA AATTGCTGCA GGGTGGTTAT GCTGCATACC 1081 GCTACGCCCA GCCTACCCCT GCCACTGCCG CTGCCTACAG TGACAGAAAT CAGTTCGTCT 1141 TCGTTGCAGC AGATGAAATT TCTTGTAACA CCTCTGCAGT TACGGACGAG TTTATGCTGC 1201 CGACCCCTAC CACCACGCAC TTGCTCCAGC CCCCACCTAC GGCGTTGGTG CCATTGCCAA 1261 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1321 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1381 TATCTTGTGG AAAGGACGAC TCAGGTTCAT GAAGTTACTC GTTACGCGTT AAGTCgacaa 1441 tcaacctctg gattacaaaa tttgtgaaag att