Transcript: Human XM_024450463.1

PREDICTED: Homo sapiens cysteine rich secretory protein LCCL domain containing 2 (CRISPLD2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRISPLD2 (83716)
Length:
1343
CDS:
228..1343

Additional Resources:

NCBI RefSeq record:
XM_024450463.1
NBCI Gene record:
CRISPLD2 (83716)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371910 ACCACAAGGCGAAGATCTTTG pLKO_005 1168 CDS 100% 10.800 8.640 N CRISPLD2 n/a
2 TRCN0000371851 TCTACTTTGTCTGCAATTATT pLKO_005 808 CDS 100% 15.000 10.500 N CRISPLD2 n/a
3 TRCN0000371912 ATGAAAGCTCGTCTAGCATAT pLKO_005 1201 CDS 100% 10.800 7.560 N CRISPLD2 n/a
4 TRCN0000195759 CGTCAGATGTGACACCAAGAT pLKO.1 1088 CDS 100% 4.950 3.465 N CRISPLD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12752 pDONR223 100% 82.3% 81.9% None (many diffs) n/a
2 ccsbBroad304_12752 pLX_304 0% 82.3% 81.9% V5 (many diffs) n/a
Download CSV