Transcript: Human XM_024450492.1

PREDICTED: Homo sapiens SLC9A3 regulator 2 (SLC9A3R2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC9A3R2 (9351)
Length:
3638
CDS:
2021..2596

Additional Resources:

NCBI RefSeq record:
XM_024450492.1
NBCI Gene record:
SLC9A3R2 (9351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043703 CGAGACAGATGAACACTTCAA pLKO.1 2305 CDS 100% 4.950 6.930 N SLC9A3R2 n/a
2 TRCN0000043704 GAAGCGTGAAATCTTCAGCAA pLKO.1 2569 CDS 100% 2.640 3.696 N SLC9A3R2 n/a
3 TRCN0000043706 GTCCTGCCATTGCCCAGAAAT pLKO.1 2696 3UTR 100% 13.200 9.240 N SLC9A3R2 n/a
4 TRCN0000443729 ACCTCAGGGCTATGGGTTCAA pLKO_005 2086 CDS 100% 4.950 3.465 N SLC9A3R2 n/a
5 TRCN0000445040 AGACCCAGAGATGTGAGAGAG pLKO_005 2797 3UTR 100% 4.050 2.835 N SLC9A3R2 n/a
6 TRCN0000043707 GATGAACACTTCAAGCGGCTT pLKO.1 2312 CDS 100% 2.160 1.512 N SLC9A3R2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450492.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02147 pDONR223 100% 56.3% 55.7% None (many diffs) n/a
2 ccsbBroad304_02147 pLX_304 0% 56.3% 55.7% V5 (many diffs) n/a
3 TRCN0000475544 AAACATCCATCCACGTGAAGCTGT pLX_317 13.9% 56.3% 55.7% V5 (many diffs) n/a
4 ccsbBroadEn_07400 pDONR223 100% 56.2% 55.7% None (many diffs) n/a
5 ccsbBroad304_07400 pLX_304 0% 56.2% 55.7% V5 (many diffs) n/a
6 TRCN0000470457 AGCGTTCCGTTCCTCATGTGAGCA pLX_317 44% 56.2% 55.7% V5 (many diffs) n/a
Download CSV