Transcript: Human XM_024450549.1

PREDICTED: Homo sapiens StAR related lipid transfer domain containing 3 (STARD3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STARD3 (10948)
Length:
2794
CDS:
566..1501

Additional Resources:

NCBI RefSeq record:
XM_024450549.1
NBCI Gene record:
STARD3 (10948)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150515 GAGATCATCCAGTACAACTTT pLKO.1 51 5UTR 100% 5.625 7.875 N STARD3 n/a
2 TRCN0000155584 CGGCAAGACGTTTATCCTGAA pLKO.1 1000 CDS 100% 4.050 5.670 N STARD3 n/a
3 TRCN0000154250 CAGGAAGAGAACTGGAAGTTT pLKO.1 926 CDS 100% 5.625 3.938 N STARD3 n/a
4 TRCN0000155040 GACCTGGTTCCTTGACTTCAA pLKO.1 658 CDS 100% 4.950 3.465 N STARD3 n/a
5 TRCN0000155552 CCAGTGCATTCCTCATTGTCA pLKO.1 177 5UTR 100% 3.000 2.100 N STARD3 n/a
6 TRCN0000152657 GTTTGCACCTTTGTCTGGATT pLKO.1 1358 CDS 100% 4.950 2.970 N STARD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15734 pDONR223 0% 68.6% 68% None (many diffs) n/a
2 ccsbBroad304_15734 pLX_304 0% 68.6% 68% V5 (many diffs) n/a
3 TRCN0000468040 CTAAGGAAATATCTCCTATTACTT pLX_317 34.7% 68.6% 68% V5 (many diffs) n/a
4 ccsbBroadEn_07713 pDONR223 100% 68.6% 68% None (many diffs) n/a
5 ccsbBroad304_07713 pLX_304 0% 68.6% 68% V5 (many diffs) n/a
6 TRCN0000470831 GTTGAAGCGACTACGGCTACTTCT pLX_317 34.7% 68.6% 68% V5 (many diffs) n/a
7 ccsbBroadEn_15735 pDONR223 0% 68.6% 67.8% None (many diffs) n/a
8 ccsbBroad304_15735 pLX_304 0% 68.6% 67.8% V5 (many diffs) n/a
9 TRCN0000470662 TGTCAAACGCATTTCTTCACGCTT pLX_317 32.6% 68.6% 67.8% V5 (many diffs) n/a
Download CSV