Transcript: Human XM_024450554.1

PREDICTED: Homo sapiens phospholipase C delta 3 (PLCD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCD3 (113026)
Length:
3591
CDS:
115..2619

Additional Resources:

NCBI RefSeq record:
XM_024450554.1
NBCI Gene record:
PLCD3 (113026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437927 GCAGTGTGGCTACGTCCTAAA pLKO_005 2145 CDS 100% 10.800 15.120 N PLCD3 n/a
2 TRCN0000437494 AGCGAGCGCAAAGCCAAGAAA pLKO_005 1789 CDS 100% 5.625 3.938 N PLCD3 n/a
3 TRCN0000053687 CCTCACCTCCAAGATTCTCTT pLKO.1 1314 CDS 100% 4.950 3.465 N PLCD3 n/a
4 TRCN0000053683 CGTGCTCAACAATGGCTTCAA pLKO.1 2367 CDS 100% 4.950 3.465 N PLCD3 n/a
5 TRCN0000053684 GCCAGTTTACACTGCCTCTTA pLKO.1 2495 CDS 100% 4.950 3.465 N PLCD3 n/a
6 TRCN0000053686 GCGGATGAACTCAGCCAACTA pLKO.1 2019 CDS 100% 4.950 3.465 N PLCD3 n/a
7 TRCN0000053685 CGTGGACATGAACGACATGTA pLKO.1 759 CDS 100% 0.495 0.347 N PLCD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09384 pDONR223 100% 94.5% 94.6% None 1450T>C;1709_1843del n/a
2 TRCN0000476382 GCCGCCGGCAGGTACTAGGAGAGC pLX_317 13.3% 94.5% 94.6% V5 1450T>C;1709_1843del n/a
Download CSV