Transcript: Human XM_024450589.1

PREDICTED: Homo sapiens target of myb1 like 2 membrane trafficking protein (TOM1L2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOM1L2 (146691)
Length:
5525
CDS:
94..1398

Additional Resources:

NCBI RefSeq record:
XM_024450589.1
NBCI Gene record:
TOM1L2 (146691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450589.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065327 CGTGACGGCTTTGACATGTTT pLKO.1 1075 CDS 100% 5.625 7.875 N TOM1L2 n/a
2 TRCN0000065323 CGAGATTTCATCGACAGTGTT pLKO.1 367 CDS 100% 4.950 6.930 N TOM1L2 n/a
3 TRCN0000065325 CCCACCATTGTACAGGACAAA pLKO.1 421 CDS 100% 4.950 3.465 N TOM1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450589.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04992 pDONR223 100% 75.7% 75.7% None 217_366del;500_501ins159;1118_1119ins60 n/a
2 ccsbBroad304_04992 pLX_304 0% 75.7% 75.7% V5 217_366del;500_501ins159;1118_1119ins60 n/a
3 TRCN0000477805 TACATTACAGCGACGATCTTTAAA pLX_317 22.4% 75.7% 75.7% V5 217_366del;500_501ins159;1118_1119ins60 n/a
Download CSV