Construct: ORF TRCN0000477805
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005959.1_s317c1
- Derived from:
- ccsbBroadEn_04992
- DNA Barcode:
- TACATTACAGCGACGATCTTTAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TOM1L2 (146691)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477805
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001033551.3 | 100% | 100% | |
| 2 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | XM_011523662.1 | 94% | 94% | 1128_1214del |
| 3 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001288787.2 | 91.6% | 88.9% | (many diffs) |
| 4 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001082968.2 | 90.1% | 90.1% | 217_366del |
| 5 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001350331.2 | 87.4% | 84.6% | (many diffs) |
| 6 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | XM_005256462.1 | 86.4% | 83.7% | (many diffs) |
| 7 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001350333.2 | 86.1% | 86.1% | 217_366del;1277_1278ins60 |
| 8 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001350332.2 | 85.2% | 85.2% | 217_366del;1278_1364del |
| 9 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001288788.2 | 80% | 76.2% | (many diffs) |
| 10 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | XM_005256466.1 | 79.3% | 75.8% | (many diffs) |
| 11 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | XM_024450589.1 | 75.7% | 75.7% | 217_366del;500_501ins159;1118_1119ins60 |
| 12 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001288786.2 | 75.3% | 75.3% | 217_366del;500_501ins159;1119_1205del |
| 13 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | NM_001288789.2 | 73.8% | 73.8% | 216_217ins294;834_920del |
| 14 | human | 146691 | TOM1L2 | target of myb1 like 2 membr... | XR_933976.2 | 20.4% | (many diffs) | |
| 15 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | NM_153080.2 | 79% | 85.2% | (many diffs) |
| 16 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | XM_011248906.2 | 76.1% | 81.8% | (many diffs) |
| 17 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | XM_006532861.3 | 76% | 81.8% | (many diffs) |
| 18 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | NM_001039092.3 | 75.3% | 81.2% | (many diffs) |
| 19 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | XM_011248907.2 | 70.5% | 75.5% | (many diffs) |
| 20 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | XM_011248908.2 | 68.1% | 71.9% | (many diffs) |
| 21 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | XM_006532867.3 | 67.2% | 68% | (many diffs) |
| 22 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | NM_001039093.1 | 66.4% | 70.3% | (many diffs) |
| 23 | mouse | 216810 | Tom1l2 | target of myb1-like 2 (chic... | XM_017314451.1 | 61.6% | 61.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1437
- ORF length:
- 1371
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gttcctcctg gggaacccgt tcagcacacc agtggggcag tgcctcgaaa 121 aggcaacaga tggctccctg caaagtgagg attggacgtt gaatatggag atctgtgaca 181 tcatcaatga gacggaggaa gggccaaagg atgccattcg agccctgaag aagcggctca 241 acgggaaccg gaactacaga gaggtgatgc tggcattaac agcatgggct gatgcctttc 301 gaagcagtcc tgatctcacc ggcgttgtgc acatatatga ggagctgaag aggaaagggg 361 ttgaatttcc catggcagac ttggacgctc tgtctcccat acacacacca cagcggagtg 421 tccctgaagt ggatccagct gcgaccatgc ccaggtccca atcacagcag aggacaagtg 481 ctggttccta ttcctcgccg cctcctgctc cctactccgc accgcaggcc ccagctctga 541 gtgtgactgg ccccatcaca gccaattcag aacagattgc caggctgcgg agtgaactgg 601 acgtcgttcg aggaaacaca aaagtcatgt ctgagatgtt aacagaaatg gtccctggac 661 aggaggattc atctgatctg gagttgctgc aggagctcaa caggacctgt cgggccatgc 721 agcagcgcat cgtggagctc atctcccgcg tgtccaatga ggaggtcacc gaggagctgc 781 tgcatgtgaa cgatgacctc aacaacgtct tccttcgata cgagaggttc gaacgataca 841 ggtctggccg atccgttcaa aatgccagta atggagtact gaatgaagta accgaagaca 901 acttaataga cctggggcca gggtctccag ccgtggtgag cccaatggtg gggaacacag 961 cgcccccatc ttccctctcc tcccagcttg caggcttaga cttggggaca gagagcgtca 1021 gtggcaccct cagttcactc cagcaatgta atccccgtga cggctttgac atgtttgccc 1081 agacgagagg aaactccttg gctgagcagc gcaagacggt aacctatgag gatccTCAGG 1141 CTGTCGGAGG ACTTGCTTCT GCACTAGACA ATCGAAAACA GAGTTCAGAA GGGATCCCCG 1201 TTGCGCAGCC ATCTGTCATG GACGACATTG AGGTGTGGCT CAGGACCGAC CTGAAGGGTG 1261 ATGATCTGGA GGAGGGTGTC ACAAGTGAAG AGTTTGATAA ATTCCTTGAA GAAAGAGCCA 1321 AAGCTGCTGA AATGGTTCCC GACCTCCCCT CGCCCCCCAT GGAGGCTCCT GCCCCAGCCT 1381 CAAACCCTTC TGGCCGGAAG AAGCCAGAGC GGTCAGAGGA TGCCCTCTTC GCCCTGTGCC 1441 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1501 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1561 ATATATCTTG TGGAAAGGAC GATACATTAC AGCGACGATC TTTAAAACGC GTTAAGTCga 1621 caatcaacct ctggattaca aaatttgtga aagatt