Transcript: Human XM_024450721.1

PREDICTED: Homo sapiens G protein pathway suppressor 1 (GPS1), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPS1 (2873)
Length:
1995
CDS:
36..1652

Additional Resources:

NCBI RefSeq record:
XM_024450721.1
NBCI Gene record:
GPS1 (2873)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036865 GAGAACCTTTAACGTGGACAT pLKO.1 284 CDS 100% 4.050 3.240 N GPS1 n/a
2 TRCN0000289566 GAGAACCTTTAACGTGGACAT pLKO_005 284 CDS 100% 4.050 3.240 N GPS1 n/a
3 TRCN0000036864 CCGAGACATCATCTTCAAATT pLKO.1 998 CDS 100% 13.200 9.240 N GPS1 n/a
4 TRCN0000289511 CCGAGACATCATCTTCAAATT pLKO_005 998 CDS 100% 13.200 9.240 N GPS1 n/a
5 TRCN0000036868 CCGTGCCCTCATCCAGTATTT pLKO.1 1211 CDS 100% 13.200 9.240 N GPS1 n/a
6 TRCN0000289508 CCGTGCCCTCATCCAGTATTT pLKO_005 1211 CDS 100% 13.200 9.240 N GPS1 n/a
7 TRCN0000036866 CCGCAACCAGATCCATGTCAA pLKO.1 1478 CDS 100% 4.950 3.465 N GPS1 n/a
8 TRCN0000289509 CCGCAACCAGATCCATGTCAA pLKO_005 1478 CDS 100% 4.950 3.465 N GPS1 n/a
9 TRCN0000036867 CGCTGCCGGTTCAGGTGTTTA pLKO.1 40 CDS 100% 4.400 3.080 N GPS1 n/a
10 TRCN0000289565 CGCTGCCGGTTCAGGTGTTTA pLKO_005 40 CDS 100% 4.400 3.080 N GPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00683 pDONR223 100% 83.4% 82.5% None (many diffs) n/a
2 ccsbBroad304_00683 pLX_304 0% 83.4% 82.5% V5 (many diffs) n/a
3 TRCN0000474252 GCAACTCTCGCACGGCTCTTCGCT pLX_317 22.7% 83.4% 82.5% V5 (many diffs) n/a
Download CSV