Transcript: Human XM_024450806.1

PREDICTED: Homo sapiens peripheral myelin protein 22 (PMP22), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PMP22 (5376)
Length:
592
CDS:
128..484

Additional Resources:

NCBI RefSeq record:
XM_024450806.1
NBCI Gene record:
PMP22 (5376)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377472 GGCAATGGACACGCAACTGAT pLKO_005 218 CDS 100% 4.950 6.930 N PMP22 n/a
2 TRCN0000430954 CACGATCGTCAGCCAATGGAT pLKO_005 193 CDS 100% 3.000 4.200 N PMP22 n/a
3 TRCN0000303572 TGTCGATCATCTTCAGCATTC pLKO_005 339 CDS 100% 6.000 4.200 N PMP22 n/a
4 TRCN0000082805 CCTGTTCTTCTGCCAACTCTT pLKO.1 370 CDS 100% 4.950 3.465 N PMP22 n/a
5 TRCN0000333294 CCTGTTCTTCTGCCAACTCTT pLKO_005 370 CDS 100% 4.950 3.465 N PMP22 n/a
6 TRCN0000303571 ATCACTGGAATCTTCCAAATT pLKO_005 419 CDS 100% 13.200 7.920 N PMP22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01229 pDONR223 100% 65.9% 68.1% None (many diffs) n/a
2 ccsbBroad304_01229 pLX_304 0% 65.9% 68.1% V5 (many diffs) n/a
3 TRCN0000473943 CCCATGCGTATATCACGGGGATAC pLX_317 70.6% 65.9% 68.1% V5 (many diffs) n/a
Download CSV