Transcript: Human XM_024450821.1

PREDICTED: Homo sapiens coiled-coil domain containing 40 (CCDC40), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC40 (55036)
Length:
4851
CDS:
685..4023

Additional Resources:

NCBI RefSeq record:
XM_024450821.1
NBCI Gene record:
CCDC40 (55036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267584 CGGCGAGATTGAGGCCTATAA pLKO_005 2187 CDS 100% 13.200 18.480 N CCDC40 n/a
2 TRCN0000253736 GCGAAGAGGAATATTACTATA pLKO_005 866 CDS 100% 13.200 10.560 N CCDC40 n/a
3 TRCN0000253735 TTAGCCACTCAGCAATTTAAT pLKO_005 4183 3UTR 100% 15.000 10.500 N CCDC40 n/a
4 TRCN0000253738 AGCTCAACATGTTGATGAATA pLKO_005 3119 CDS 100% 13.200 9.240 N CCDC40 n/a
5 TRCN0000253737 GAAGCAGAACACCAGATTATG pLKO_005 3298 CDS 100% 13.200 9.240 N CCDC40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12142 pDONR223 100% 37.5% 35.9% None (many diffs) n/a
2 ccsbBroad304_12142 pLX_304 0% 37.5% 35.9% V5 (many diffs) n/a
3 TRCN0000467886 GCCACTATACTGCAATATTACCCA pLX_317 35.5% 37.5% 35.9% V5 (many diffs) n/a
Download CSV