Transcript: Human XM_024450831.1

PREDICTED: Homo sapiens ArfGAP with dual PH domains 2 (ADAP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAP2 (55803)
Length:
1341
CDS:
71..1282

Additional Resources:

NCBI RefSeq record:
XM_024450831.1
NBCI Gene record:
ADAP2 (55803)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450831.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145603 CAATGGATTCGAGCTAAGTAT pLKO.1 401 CDS 100% 5.625 7.875 N ADAP2 n/a
2 TRCN0000292161 CAATGGATTCGAGCTAAGTAT pLKO_005 401 CDS 100% 5.625 7.875 N ADAP2 n/a
3 TRCN0000142570 GACGACAGTATTGTGGAGTTT pLKO.1 278 CDS 100% 4.950 6.930 N ADAP2 n/a
4 TRCN0000106217 GCCTGGTCTTAAAGGAACAAT pLKO.1 384 CDS 100% 5.625 3.938 N Adap2 n/a
5 TRCN0000141961 GCCTGGTCTTAAAGGAACAAT pLKO.1 384 CDS 100% 5.625 3.938 N ADAP2 n/a
6 TRCN0000292159 GCCTGGTCTTAAAGGAACAAT pLKO_005 384 CDS 100% 5.625 3.938 N ADAP2 n/a
7 TRCN0000323877 GCCTGGTCTTAAAGGAACAAT pLKO_005 384 CDS 100% 5.625 3.938 N Adap2 n/a
8 TRCN0000139150 CAGATCACCTACAGGAGAGAT pLKO.1 665 CDS 100% 4.950 3.465 N ADAP2 n/a
9 TRCN0000141746 GAGGCTGCTCTATTACAAGAA pLKO.1 925 CDS 100% 4.950 3.465 N ADAP2 n/a
10 TRCN0000292160 GAGGCTGCTCTATTACAAGAA pLKO_005 925 CDS 100% 4.950 3.465 N ADAP2 n/a
11 TRCN0000141899 GCCAAAGCAGAAAGAACCTTT pLKO.1 868 CDS 100% 4.950 3.465 N ADAP2 n/a
12 TRCN0000292158 GCCAAAGCAGAAAGAACCTTT pLKO_005 868 CDS 100% 4.950 3.465 N ADAP2 n/a
13 TRCN0000142630 CTTCACAAAGGAACAGGGTAA pLKO.1 565 CDS 100% 4.050 2.835 N ADAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450831.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12276 pDONR223 100% 93.1% 92.3% None (many diffs) n/a
2 ccsbBroad304_12276 pLX_304 0% 93.1% 92.3% V5 (many diffs) n/a
3 TRCN0000478368 GGCCAGGCGATGAATATCAAATCT pLX_317 32.9% 93.1% 92.3% V5 (many diffs) n/a
Download CSV