Transcript: Human XM_024450903.1

PREDICTED: Homo sapiens DNA topoisomerase III alpha (TOP3A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOP3A (7156)
Length:
8093
CDS:
1167..3251

Additional Resources:

NCBI RefSeq record:
XM_024450903.1
NBCI Gene record:
TOP3A (7156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049296 CGGTGGCTAAAGCAAAGAAAT pLKO.1 2104 CDS 100% 13.200 10.560 N TOP3A n/a
2 TRCN0000296836 TCCTGAGAAGGACGGTGTAAT pLKO_005 3690 3UTR 100% 13.200 10.560 N TOP3A n/a
3 TRCN0000296838 TGATTCCATGGGCTATGAAAT pLKO_005 1961 CDS 100% 13.200 10.560 N TOP3A n/a
4 TRCN0000370354 CCACGTGTGTAAGGCTGTAAA pLKO_005 728 5UTR 100% 13.200 9.240 N TOP3A n/a
5 TRCN0000296879 GACTTCAGTTTCTGGACATTT pLKO_005 465 5UTR 100% 13.200 9.240 N TOP3A n/a
6 TRCN0000049294 CGAGTTTATTGTTCGCCATTT pLKO.1 1547 CDS 100% 10.800 7.560 N TOP3A n/a
7 TRCN0000049295 GCCAGAATGTTACCATGGTAA pLKO.1 443 5UTR 100% 4.950 3.465 N TOP3A n/a
8 TRCN0000049297 GCTTCTCGAAAGTTGAGAATA pLKO.1 1251 CDS 100% 1.320 0.924 N TOP3A n/a
9 TRCN0000291059 GCTTCTCGAAAGTTGAGAATA pLKO_005 1251 CDS 100% 1.320 0.924 N TOP3A n/a
10 TRCN0000049293 CCAGAAATCTTCCACAGAATT pLKO.1 1035 5UTR 100% 0.000 0.000 N TOP3A n/a
11 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 6089 3UTR 100% 13.200 6.600 Y CLDN18 n/a
12 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 6227 3UTR 100% 10.800 5.400 Y MRPS16 n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3914 3UTR 100% 4.950 2.475 Y ORAI2 n/a
14 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 5118 3UTR 100% 4.950 2.475 Y DENND6A n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3837 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 6227 3UTR 100% 10.800 5.400 Y CD3EAP n/a
17 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4002 3UTR 100% 10.800 5.400 Y SMIM11A n/a
18 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3911 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450903.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.