Transcript: Human XM_024451141.1

PREDICTED: Homo sapiens zinc finger protein 521 (ZNF521), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF521 (25925)
Length:
5039
CDS:
978..4253

Additional Resources:

NCBI RefSeq record:
XM_024451141.1
NBCI Gene record:
ZNF521 (25925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229708 ACGTCCAACAAGCCATATAAA pLKO_005 906 5UTR 100% 15.000 21.000 N ZNF521 n/a
2 TRCN0000229711 CTGGATAAGGCCCGTATATAT pLKO_005 4758 3UTR 100% 15.000 21.000 N ZNF521 n/a
3 TRCN0000219004 ATCACTTGAAGATCCACTTAA pLKO_005 877 5UTR 100% 13.200 10.560 N ZNF521 n/a
4 TRCN0000312871 TTGTACAAATTCGCCAATATT pLKO_005 2009 CDS 100% 15.000 10.500 N Zfp521 n/a
5 TRCN0000229709 TATGATCACTTCAACGTATTA pLKO_005 2378 CDS 100% 13.200 9.240 N ZNF521 n/a
6 TRCN0000016826 GCCCTCACTCTATAACCTAAA pLKO.1 1655 CDS 100% 10.800 7.560 N ZNF521 n/a
7 TRCN0000016825 CGCATAGTAAGAGTCTTGATA pLKO.1 3256 CDS 100% 5.625 3.938 N ZNF521 n/a
8 TRCN0000016827 GCATCAAGTGTCAGATGGTTT pLKO.1 3907 CDS 100% 4.950 3.465 N ZNF521 n/a
9 TRCN0000016824 GCCCTGAATTATATCCACAAT pLKO.1 2088 CDS 100% 4.950 3.465 N ZNF521 n/a
10 TRCN0000016823 CCCGTGTCAATTCTGTGACAA pLKO.1 671 5UTR 100% 0.495 0.347 N ZNF521 n/a
11 TRCN0000229710 ACAAGTTGCAGCAGCATATTT pLKO_005 4123 CDS 100% 15.000 9.000 N ZNF521 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466255 GTGGTTTGCAATCGTTCGATCATA pLX_317 9.7% 83.1% 83.1% V5 0_1ins660;2565_2567delTTCinsCCG;2937G>A n/a
Download CSV