Transcript: Human XM_024451154.1

PREDICTED: Homo sapiens SET binding protein 1 (SETBP1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SETBP1 (26040)
Length:
10094
CDS:
492..5282

Additional Resources:

NCBI RefSeq record:
XM_024451154.1
NBCI Gene record:
SETBP1 (26040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358516 TATTACCCGGTGCCATATATC pLKO_005 3468 CDS 100% 13.200 18.480 N SETBP1 n/a
2 TRCN0000358515 TCCGGTGCAGCTAAGCATAAA pLKO_005 3801 CDS 100% 13.200 18.480 N SETBP1 n/a
3 TRCN0000016911 CGCAGTTGACAGTGTTACAAT pLKO.1 4586 CDS 100% 5.625 7.875 N SETBP1 n/a
4 TRCN0000016910 CGTGTCCCTAAGTTGAGTAAA pLKO.1 1878 CDS 100% 13.200 9.240 N SETBP1 n/a
5 TRCN0000358517 CTTCACCGGTGACACCTTAAA pLKO_005 1091 CDS 100% 13.200 9.240 N SETBP1 n/a
6 TRCN0000016908 CCTATGATGAACCTTGGTTAT pLKO.1 3666 CDS 100% 10.800 7.560 N SETBP1 n/a
7 TRCN0000016912 CCAACCAACCATAAGAGGAAA pLKO.1 1728 CDS 100% 4.950 3.465 N SETBP1 n/a
8 TRCN0000016909 GCACCCACTTTCAACACAGTT pLKO.1 2819 CDS 100% 4.950 3.465 N SETBP1 n/a
9 TRCN0000095087 GCCTATGATGAACCTTGGTTA pLKO.1 3665 CDS 100% 4.950 3.465 N Setbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02907 pDONR223 100% 13.8% 12% None (many diffs) n/a
2 ccsbBroad304_02907 pLX_304 0% 13.8% 12% V5 (many diffs) n/a
3 TRCN0000481595 CTACTTTTCCGACAGATGATCCTT pLX_317 57.6% 13.8% 12% V5 (many diffs) n/a
Download CSV