Transcript: Human XM_024451158.1

PREDICTED: Homo sapiens SET binding protein 1 (SETBP1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SETBP1 (26040)
Length:
5008
CDS:
497..4765

Additional Resources:

NCBI RefSeq record:
XM_024451158.1
NBCI Gene record:
SETBP1 (26040)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358516 TATTACCCGGTGCCATATATC pLKO_005 3551 CDS 100% 13.200 18.480 N SETBP1 n/a
2 TRCN0000358515 TCCGGTGCAGCTAAGCATAAA pLKO_005 3884 CDS 100% 13.200 18.480 N SETBP1 n/a
3 TRCN0000016910 CGTGTCCCTAAGTTGAGTAAA pLKO.1 1961 CDS 100% 13.200 9.240 N SETBP1 n/a
4 TRCN0000358517 CTTCACCGGTGACACCTTAAA pLKO_005 1174 CDS 100% 13.200 9.240 N SETBP1 n/a
5 TRCN0000016908 CCTATGATGAACCTTGGTTAT pLKO.1 3749 CDS 100% 10.800 7.560 N SETBP1 n/a
6 TRCN0000016912 CCAACCAACCATAAGAGGAAA pLKO.1 1811 CDS 100% 4.950 3.465 N SETBP1 n/a
7 TRCN0000016909 GCACCCACTTTCAACACAGTT pLKO.1 2902 CDS 100% 4.950 3.465 N SETBP1 n/a
8 TRCN0000095087 GCCTATGATGAACCTTGGTTA pLKO.1 3748 CDS 100% 4.950 3.465 N Setbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02907 pDONR223 100% 15.5% 13.4% None (many diffs) n/a
2 ccsbBroad304_02907 pLX_304 0% 15.5% 13.4% V5 (many diffs) n/a
3 TRCN0000481595 CTACTTTTCCGACAGATGATCCTT pLX_317 57.6% 15.5% 13.4% V5 (many diffs) n/a
Download CSV