Transcript: Human XM_024451346.1

PREDICTED: Homo sapiens Purkinje cell protein 2 (PCP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCP2 (126006)
Length:
1822
CDS:
989..1747

Additional Resources:

NCBI RefSeq record:
XM_024451346.1
NBCI Gene record:
PCP2 (126006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257484 CATGGATGACCAACGTGTGAC pLKO_005 1567 CDS 100% 4.050 5.670 N PCP2 n/a
2 TRCN0000246093 ACCAGGAGGGCTTCTTCAATC pLKO_005 1401 CDS 100% 10.800 7.560 N PCP2 n/a
3 TRCN0000257491 TCCAAGGACGGAGCACAGAAA pLKO_005 1622 CDS 100% 4.950 3.465 N PCP2 n/a
4 TRCN0000257488 GATGGACAGCCTCATGGACAT pLKO_005 1522 CDS 100% 4.050 2.835 N PCP2 n/a
5 TRCN0000257482 ATGGAGGGACAGCGCTGTTCA pLKO_005 1448 CDS 100% 1.650 1.155 N PCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04806 pDONR223 100% 53.9% 47.8% None 1_163del;214_398del n/a
2 ccsbBroad304_04806 pLX_304 0% 53.9% 47.8% V5 1_163del;214_398del n/a
3 TRCN0000479812 CGCATTCCAGTCTCCTTAGGTTAC pLX_317 79.1% 53.9% 47.8% V5 1_163del;214_398del n/a
Download CSV