Transcript: Human XM_024451481.1

PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein L (HNRNPL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNRNPL (3191)
Length:
2069
CDS:
16..1725

Additional Resources:

NCBI RefSeq record:
XM_024451481.1
NBCI Gene record:
HNRNPL (3191)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221617 GCCGACAACCAAATATACATT pLKO.1 316 CDS 100% 5.625 7.875 N HNRNPL n/a
2 TRCN0000330619 GCCGACAACCAAATATACATT pLKO_005 316 CDS 100% 5.625 7.875 N HNRNPL n/a
3 TRCN0000221615 CCACGGATGTTCTTTACACTA pLKO.1 464 CDS 100% 4.950 6.930 N HNRNPL n/a
4 TRCN0000112035 CCCAAGATTAACCTTCACTTT pLKO.1 1932 3UTR 100% 4.950 6.930 N Hnrnpl n/a
5 TRCN0000287716 CCCAAGATTAACCTTCACTTT pLKO_005 1932 3UTR 100% 4.950 6.930 N Hnrnpl n/a
6 TRCN0000330565 TAGAGGCTTACTTAACCTTAA pLKO_005 1863 3UTR 100% 10.800 7.560 N HNRNPL n/a
7 TRCN0000221618 CCATCAGCTATGTGGTGGTAA pLKO.1 224 CDS 100% 4.950 3.465 N HNRNPL n/a
8 TRCN0000221616 CCTCAACAACAACTTCATGTT pLKO.1 1269 CDS 100% 4.950 3.465 N HNRNPL n/a
9 TRCN0000330564 CCTCAACAACAACTTCATGTT pLKO_005 1269 CDS 100% 4.950 3.465 N HNRNPL n/a
10 TRCN0000112039 CCTGAACCATTACCAGATGAA pLKO.1 1638 CDS 100% 4.950 3.465 N Hnrnpl n/a
11 TRCN0000287717 CCTGAACCATTACCAGATGAA pLKO_005 1638 CDS 100% 4.950 3.465 N Hnrnpl n/a
12 TRCN0000112038 CCTGTCCAGAGAATTGTCATT pLKO.1 502 CDS 100% 4.950 3.465 N Hnrnpl n/a
13 TRCN0000287715 CCTGTCCAGAGAATTGTCATT pLKO_005 502 CDS 100% 4.950 3.465 N Hnrnpl n/a
14 TRCN0000017243 CGCTTGAATGTGTTCAAGAAT pLKO.1 658 CDS 100% 0.563 0.394 N HNRNPL n/a
15 TRCN0000330620 CGCTTGAATGTGTTCAAGAAT pLKO_005 658 CDS 100% 0.563 0.394 N HNRNPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.