Transcript: Human XM_024451499.1

PREDICTED: Homo sapiens NADH:ubiquinone oxidoreductase core subunit S7 (NDUFS7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDUFS7 (374291)
Length:
782
CDS:
24..686

Additional Resources:

NCBI RefSeq record:
XM_024451499.1
NBCI Gene record:
NDUFS7 (374291)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236588 CGGCACACTCACCAACAAGAT pLKO_005 413 CDS 100% 4.950 6.930 N NDUFS7 n/a
2 TRCN0000220400 TCGCAAGGTCTACGACCAGAT pLKO.1 446 CDS 100% 4.050 5.670 N NDUFS7 n/a
3 TRCN0000236590 TTCGCAAGGTCTACGACCAGA pLKO_005 445 CDS 100% 2.640 3.696 N NDUFS7 n/a
4 TRCN0000236589 AGGAGGCTACTACCACTATTC pLKO_005 512 CDS 100% 10.800 8.640 N NDUFS7 n/a
5 TRCN0000220397 CGCCGTGGAGATGATGCACAT pLKO.1 311 CDS 100% 1.350 1.080 N NDUFS7 n/a
6 TRCN0000220398 GAGGAGGCTACTACCACTATT pLKO.1 511 CDS 100% 13.200 9.240 N NDUFS7 n/a
7 TRCN0000236587 GCTACGACATGGACCGCTTTG pLKO_005 343 CDS 100% 2.000 1.400 N NDUFS7 n/a
8 TRCN0000257074 CATCGTGCCCGTGGACATCTA pLKO_005 560 CDS 100% 1.650 1.155 N NDUFS7 n/a
9 TRCN0000220401 CGTGCCCGTGGACATCTACAT pLKO.1 563 CDS 100% 1.650 1.155 N NDUFS7 n/a
10 TRCN0000220399 CCGCTACGACATGGACCGCTT pLKO.1 341 CDS 100% 0.000 0.000 N NDUFS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451499.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10064 pDONR223 100% 83.9% 80% None (many diffs) n/a
2 ccsbBroad304_10064 pLX_304 0% 83.9% 80% V5 (many diffs) n/a
3 TRCN0000468088 CGAGGACATCAGGCACGATTTAAC pLX_317 58.5% 83.9% 80% V5 (many diffs) n/a
Download CSV