Transcript: Human XM_024451513.1

PREDICTED: Homo sapiens DNA ligase 1 (LIG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIG1 (3978)
Length:
3268
CDS:
413..3064

Additional Resources:

NCBI RefSeq record:
XM_024451513.1
NBCI Gene record:
LIG1 (3978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431836 ACCGGAAGCAAAGTCAGATTC pLKO_005 2994 CDS 100% 10.800 15.120 N LIG1 n/a
2 TRCN0000048494 CGGTTTATTCGAGTCCGTGAA pLKO.1 2924 CDS 100% 4.050 5.670 N LIG1 n/a
3 TRCN0000048493 CCTGCCAAGAACAACTATCAT pLKO.1 1106 CDS 100% 5.625 4.500 N LIG1 n/a
4 TRCN0000439753 GCAGCTTTCACCTGCGAATAC pLKO_005 1985 CDS 100% 10.800 7.560 N LIG1 n/a
5 TRCN0000048495 GCTCAAGCTGAAGAAGGACTA pLKO.1 2530 CDS 100% 4.050 2.835 N LIG1 n/a
6 TRCN0000048496 CCAAGAAAGAGGGTAAAGCAA pLKO.1 444 CDS 100% 3.000 2.100 N LIG1 n/a
7 TRCN0000048497 CTGAAACCAATGTTGGCCCAT pLKO.1 1922 CDS 100% 2.160 1.512 N LIG1 n/a
8 TRCN0000439464 TCCTGGAGCAGTCAGTGAAAG pLKO_005 2433 CDS 100% 10.800 6.480 N LIG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06523 pDONR223 100% 96% 96% None 466_467ins108 n/a
2 ccsbBroad304_06523 pLX_304 0% 96% 96% V5 466_467ins108 n/a
3 TRCN0000480678 CGAATTCGAACCGTGTCGTTGAGG pLX_317 14.1% 96% 96% V5 466_467ins108 n/a
Download CSV