Transcript: Human XM_024451634.1

PREDICTED: Homo sapiens zinc finger protein 350 (ZNF350), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF350 (59348)
Length:
3640
CDS:
2206..3126

Additional Resources:

NCBI RefSeq record:
XM_024451634.1
NBCI Gene record:
ZNF350 (59348)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424359 TTGCTCGACTGTGTCAATTAA pLKO_005 3309 3UTR 100% 15.000 21.000 N ZNF350 n/a
2 TRCN0000419163 TTGGTGGGAAAGGGCTAATAC pLKO_005 3451 3UTR 100% 13.200 18.480 N ZNF350 n/a
3 TRCN0000108063 GCGTATATGTCGTGTCTGGTT pLKO.1 2761 CDS 100% 2.640 3.696 N ZNF350 n/a
4 TRCN0000108064 CAGAGCAAAGGCTATGAAATA pLKO.1 1960 5UTR 100% 13.200 9.240 N ZNF350 n/a
5 TRCN0000108060 CCTGATAAACTCATCCTATTA pLKO.1 3230 3UTR 100% 13.200 9.240 N ZNF350 n/a
6 TRCN0000429676 CTAACTGATCACCAGGTAATG pLKO_005 2188 5UTR 100% 10.800 7.560 N ZNF350 n/a
7 TRCN0000108062 GCAAACAGGAACGTAGTCCTT pLKO.1 2965 CDS 100% 2.640 1.848 N ZNF350 n/a
8 TRCN0000108061 GCTAACCATGAACGACTTCAT pLKO.1 2026 5UTR 100% 0.495 0.347 N ZNF350 n/a
9 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 2150 5UTR 100% 3.000 1.500 Y ZNF146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08786 pDONR223 100% 57.5% 57.5% None 0_1ins678 n/a
2 ccsbBroad304_08786 pLX_304 0% 57.5% 57.5% V5 0_1ins678 n/a
3 TRCN0000473440 TTTTCTGCAGACATACCTTTACCA pLX_317 32.6% 57.5% 57.5% V5 0_1ins678 n/a
Download CSV