Transcript: Human XM_024451914.1

PREDICTED: Homo sapiens YTH N6-methyladenosine RNA binding protein 1 (YTHDF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YTHDF1 (54915)
Length:
3016
CDS:
208..1737

Additional Resources:

NCBI RefSeq record:
XM_024451914.1
NBCI Gene record:
YTHDF1 (54915)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294207 ATCGGTCTAAAGTGCTAATTT pLKO_005 2225 3UTR 100% 15.000 21.000 N YTHDF1 n/a
2 TRCN0000062772 CGGTGGGACAAATGTGAACAT pLKO.1 714 CDS 100% 4.950 6.930 N YTHDF1 n/a
3 TRCN0000062771 GTTCGTTACATCAGAAGGATA pLKO.1 119 5UTR 100% 4.950 3.960 N YTHDF1 n/a
4 TRCN0000286872 GTTCGTTACATCAGAAGGATA pLKO_005 119 5UTR 100% 4.950 3.960 N YTHDF1 n/a
5 TRCN0000294275 CCCTACCTGTCCAGCTATTAC pLKO_005 217 CDS 100% 13.200 9.240 N YTHDF1 n/a
6 TRCN0000294208 ACGACATCCACCGCTCCATTA pLKO_005 1256 CDS 100% 10.800 7.560 N YTHDF1 n/a
7 TRCN0000062769 GCCGTCCATTGGATTTCCTTA pLKO.1 240 CDS 100% 4.950 3.465 N YTHDF1 n/a
8 TRCN0000062768 GCTGGAGAATAACGACAACAA pLKO.1 1536 CDS 100% 4.950 3.465 N YTHDF1 n/a
9 TRCN0000062770 CCCGAAAGAGTTTGAGTGGAA pLKO.1 1191 CDS 100% 2.640 1.848 N YTHDF1 n/a
10 TRCN0000286871 CCCGAAAGAGTTTGAGTGGAA pLKO_005 1191 CDS 100% 2.640 1.848 N YTHDF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03479 pDONR223 100% 91% 91% None 0_1ins150 n/a
2 ccsbBroad304_03479 pLX_304 0% 91% 91% V5 0_1ins150 n/a
3 TRCN0000477232 TATTTGTGTCTGACGGCAGTTCAT pLX_317 8.9% 91% 91% V5 0_1ins150 n/a
Download CSV