Transcript: Human XM_024451950.1

PREDICTED: Homo sapiens zinc finger protein 512B (ZNF512B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF512B (57473)
Length:
6537
CDS:
98..3352

Additional Resources:

NCBI RefSeq record:
XM_024451950.1
NBCI Gene record:
ZNF512B (57473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127718 GTTCTGAGAGTGGCGTCAAAT pLKO.1 3054 CDS 100% 13.200 18.480 N ZNF512B n/a
2 TRCN0000232819 GTTCTGAGAGTGGCGTCAAAT pLKO_005 3054 CDS 100% 13.200 18.480 N ZNF512B n/a
3 TRCN0000232816 CTACGGGCTCAAGTACCATTA pLKO_005 496 CDS 100% 10.800 15.120 N ZNF512B n/a
4 TRCN0000232817 TGAGCAAACCTGTCACTATTG pLKO_005 720 CDS 100% 10.800 15.120 N ZNF512B n/a
5 TRCN0000127981 GAGTGGCGTCAAATACCACAT pLKO.1 3061 CDS 100% 4.050 5.670 N ZNF512B n/a
6 TRCN0000128121 CAAACCCATCACAGTCACCAA pLKO.1 904 CDS 100% 2.640 3.696 N ZNF512B n/a
7 TRCN0000232820 CTATCACTTGTAACCATATAT pLKO_005 6317 3UTR 100% 15.000 12.000 N ZNF512B n/a
8 TRCN0000130455 GAGATGTTTCAACGGTGAGTT pLKO.1 6376 3UTR 100% 4.950 3.960 N ZNF512B n/a
9 TRCN0000128650 CAAACCCATTACGGTAACAAA pLKO.1 958 CDS 100% 5.625 3.938 N ZNF512B n/a
10 TRCN0000130566 CCAGTCTTGTTGCTGTGACAA pLKO.1 4806 3UTR 100% 4.950 3.465 N ZNF512B n/a
11 TRCN0000127528 CGCACAAAGCACAGAAGGAAA pLKO.1 1388 CDS 100% 4.950 3.465 N ZNF512B n/a
12 TRCN0000127529 CGGAAGCAGTTCAAGTCCAAA pLKO.1 1775 CDS 100% 4.950 3.465 N ZNF512B n/a
13 TRCN0000128958 GCACTTTATTTGCTGGTGCAA pLKO.1 6033 3UTR 100% 2.640 1.848 N ZNF512B n/a
14 TRCN0000232818 TACCTGTCACCAAACCCATTA pLKO_005 948 CDS 100% 0.000 0.000 N ZNF512B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08732 pDONR223 100% 82.2% 82.2% None 1_42del;1356A>C;2369_2902del n/a
2 ccsbBroad304_08732 pLX_304 0% 82.2% 82.2% V5 1_42del;1356A>C;2369_2902del n/a
3 TRCN0000470092 GCTGGTGTTTCCAAGGCATACGTT pLX_317 18.5% 82.2% 82.2% V5 1_42del;1356A>C;2369_2902del n/a
4 ccsbBroadEn_08733 pDONR223 100% 82.1% 82.2% None (many diffs) n/a
5 ccsbBroad304_08733 pLX_304 0% 82.1% 82.2% V5 (many diffs) n/a
6 TRCN0000475732 ATACGGCGTCCGCCCCGCTACCTT pLX_317 12.9% 82.1% 82.2% V5 (many diffs) n/a
Download CSV