Transcript: Human XM_024451954.1

PREDICTED: Homo sapiens zinc finger protein 512B (ZNF512B), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF512B (57473)
Length:
5864
CDS:
457..2679

Additional Resources:

NCBI RefSeq record:
XM_024451954.1
NBCI Gene record:
ZNF512B (57473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127718 GTTCTGAGAGTGGCGTCAAAT pLKO.1 2381 CDS 100% 13.200 18.480 N ZNF512B n/a
2 TRCN0000232819 GTTCTGAGAGTGGCGTCAAAT pLKO_005 2381 CDS 100% 13.200 18.480 N ZNF512B n/a
3 TRCN0000127981 GAGTGGCGTCAAATACCACAT pLKO.1 2388 CDS 100% 4.050 5.670 N ZNF512B n/a
4 TRCN0000232820 CTATCACTTGTAACCATATAT pLKO_005 5644 3UTR 100% 15.000 12.000 N ZNF512B n/a
5 TRCN0000130455 GAGATGTTTCAACGGTGAGTT pLKO.1 5703 3UTR 100% 4.950 3.960 N ZNF512B n/a
6 TRCN0000130566 CCAGTCTTGTTGCTGTGACAA pLKO.1 4133 3UTR 100% 4.950 3.465 N ZNF512B n/a
7 TRCN0000127528 CGCACAAAGCACAGAAGGAAA pLKO.1 715 CDS 100% 4.950 3.465 N ZNF512B n/a
8 TRCN0000127529 CGGAAGCAGTTCAAGTCCAAA pLKO.1 1102 CDS 100% 4.950 3.465 N ZNF512B n/a
9 TRCN0000128958 GCACTTTATTTGCTGGTGCAA pLKO.1 5360 3UTR 100% 2.640 1.848 N ZNF512B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08732 pDONR223 100% 52.3% 52% None (many diffs) n/a
2 ccsbBroad304_08732 pLX_304 0% 52.3% 52% V5 (many diffs) n/a
3 TRCN0000470092 GCTGGTGTTTCCAAGGCATACGTT pLX_317 18.5% 52.3% 52% V5 (many diffs) n/a
4 ccsbBroadEn_08733 pDONR223 100% 52.2% 52% None (many diffs) n/a
5 ccsbBroad304_08733 pLX_304 0% 52.2% 52% V5 (many diffs) n/a
6 TRCN0000475732 ATACGGCGTCCGCCCCGCTACCTT pLX_317 12.9% 52.2% 52% V5 (many diffs) n/a
Download CSV