Transcript: Human XM_024451972.1

PREDICTED: Homo sapiens bactericidal permeability increasing protein (BPI), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BPI (671)
Length:
1127
CDS:
48..806

Additional Resources:

NCBI RefSeq record:
XM_024451972.1
NBCI Gene record:
BPI (671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158637 CGACTCAGATTCAGAAATGAT pLKO.1 928 3UTR 100% 5.625 4.500 N BPI n/a
2 TRCN0000161352 GACCCTTAGAGATGACATGAT pLKO.1 380 CDS 100% 4.950 3.960 N BPI n/a
3 TRCN0000160060 CAAACTTCTTCGACTCAGATT pLKO.1 918 3UTR 100% 4.950 3.465 N BPI n/a
4 TRCN0000161956 GATGACCCTTAGAGATGACAT pLKO.1 377 CDS 100% 4.950 3.465 N BPI n/a
5 TRCN0000161098 GCTGCAGGATATCATGAACTA pLKO.1 635 CDS 100% 4.950 3.465 N BPI n/a
6 TRCN0000163621 GTCTGCGAGAAAGTGACCAAT pLKO.1 66 CDS 100% 4.950 2.970 N BPI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05903 pDONR223 100% 51.3% 50.5% None (many diffs) n/a
2 ccsbBroad304_05903 pLX_304 0% 51.3% 50.5% V5 (many diffs) n/a
3 TRCN0000466795 ATCAAGGGCCTAAGGTAAACAGCT pLX_317 28.2% 51.3% 50.5% V5 (many diffs) n/a
Download CSV