Transcript: Human XM_024452135.1

PREDICTED: Homo sapiens proteasome assembly chaperone 1 (PSMG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSMG1 (8624)
Length:
1029
CDS:
292..897

Additional Resources:

NCBI RefSeq record:
XM_024452135.1
NBCI Gene record:
PSMG1 (8624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117846 CCGTGCTCCAAGTTTATAATT pLKO.1 229 5UTR 100% 15.000 21.000 N PSMG1 n/a
2 TRCN0000300752 CCGTGCTCCAAGTTTATAATT pLKO_005 229 5UTR 100% 15.000 21.000 N PSMG1 n/a
3 TRCN0000117845 GTCGACATGTTACCGATTATA pLKO.1 536 CDS 100% 15.000 21.000 N PSMG1 n/a
4 TRCN0000300824 GTCGACATGTTACCGATTATA pLKO_005 536 CDS 100% 15.000 21.000 N PSMG1 n/a
5 TRCN0000117843 CCGAATATAGTACACGACCTT pLKO.1 655 CDS 100% 2.640 3.696 N PSMG1 n/a
6 TRCN0000331666 CCGAATATAGTACACGACCTT pLKO_005 655 CDS 100% 2.640 3.696 N PSMG1 n/a
7 TRCN0000117844 GCAATTCTGTACTTGTGTTAT pLKO.1 718 CDS 100% 13.200 9.240 N PSMG1 n/a
8 TRCN0000300823 GCAATTCTGTACTTGTGTTAT pLKO_005 718 CDS 100% 13.200 9.240 N PSMG1 n/a
9 TRCN0000117842 GCACTGAGATACTAAAGAAAT pLKO.1 836 CDS 100% 13.200 9.240 N PSMG1 n/a
10 TRCN0000300822 GCACTGAGATACTAAAGAAAT pLKO_005 836 CDS 100% 13.200 9.240 N PSMG1 n/a
11 TRCN0000437641 TCCTTTCCTGAGAGCCCTAAA pLKO_005 588 CDS 100% 10.800 7.560 N Psmg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07275 pDONR223 100% 69.5% 69.7% None 0_1ins261;426A>G;588G>A n/a
2 ccsbBroad304_07275 pLX_304 0% 69.5% 69.7% V5 0_1ins261;426A>G;588G>A n/a
3 TRCN0000470167 AGACGGCTTAACTCGTTCTTCCAC pLX_317 55.2% 69.5% 69.7% V5 0_1ins261;426A>G;588G>A n/a
Download CSV