Transcript: Human XM_024452241.1

PREDICTED: Homo sapiens arylsulfatase A (ARSA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARSA (410)
Length:
1764
CDS:
214..1377

Additional Resources:

NCBI RefSeq record:
XM_024452241.1
NBCI Gene record:
ARSA (410)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371344 CATCAGGGCTTCCATCGATTT pLKO_005 631 CDS 100% 10.800 15.120 N ARSA n/a
2 TRCN0000371343 AGAGCTTTGCAGAGCGTTCAG pLKO_005 926 CDS 100% 4.050 5.670 N ARSA n/a
3 TRCN0000050153 CCCAACATCGTGCTGATCTTT pLKO.1 280 CDS 100% 5.625 3.938 N ARSA n/a
4 TRCN0000371342 GACCTGAGACCATGCGTATGT pLKO_005 1067 CDS 100% 4.950 3.465 N ARSA n/a
5 TRCN0000050154 GCTGCGGTTCACAGACTTCTA pLKO.1 387 CDS 100% 4.950 3.465 N ARSA n/a
6 TRCN0000050156 CCACACCCACTACCCTCAGTT pLKO.1 897 CDS 100% 1.650 1.155 N ARSA n/a
7 TRCN0000050157 CGGTCTCTTGCGGTGTGGAAA pLKO.1 1104 CDS 100% 1.650 1.155 N ARSA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10421 pDONR223 100% 75.6% 72.3% None 1_6delATGTCC;1106_1107ins103;1161_1162ins263 n/a
2 ccsbBroad304_10421 pLX_304 0% 75.6% 72.3% V5 1_6delATGTCC;1106_1107ins103;1161_1162ins263 n/a
3 TRCN0000472473 TTCTCAGGGTCTATCAGGGAACCA pLX_317 24% 75.6% 72.3% V5 1_6delATGTCC;1106_1107ins103;1161_1162ins263 n/a
Download CSV