Transcript: Human XM_024452248.1

PREDICTED: Homo sapiens DENN domain containing 6B (DENND6B), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND6B (414918)
Length:
1568
CDS:
418..1392

Additional Resources:

NCBI RefSeq record:
XM_024452248.1
NBCI Gene record:
DENND6B (414918)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122293 CCTAAGCAAGTCAAGCTGAAA pLKO.1 715 CDS 100% 4.950 3.960 N DENND6B n/a
2 TRCN0000122162 GAGTCACAAACCCTTTCTTTA pLKO.1 629 CDS 100% 13.200 9.240 N DENND6B n/a
3 TRCN0000184022 CGAAGCAGTTTGACCAAGAGA pLKO.1 317 5UTR 100% 3.000 2.100 N DENND6B n/a
4 TRCN0000184671 CCTGAAACTTCGTGAGAAGCT pLKO.1 1248 CDS 100% 2.640 1.848 N DENND6B n/a
5 TRCN0000184318 GCTGACTCATATGCAGACACT pLKO.1 408 5UTR 100% 0.000 0.000 N DENND6B n/a
6 TRCN0000184193 GAACATCGAGACCTGGATGAA pLKO.1 1194 CDS 100% 4.950 2.970 N DENND6B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10154 pDONR223 100% 55.3% 55.3% None 0_1ins783 n/a
2 ccsbBroad304_10154 pLX_304 0% 55.3% 55.3% V5 0_1ins783 n/a
3 TRCN0000481297 CCTCCCTGTAGCTGTAGCCGACGT pLX_317 25% 55.3% 55.3% V5 0_1ins783 n/a
Download CSV