Transcript: Human XM_024452344.1

PREDICTED: Homo sapiens terminal nucleotidyltransferase 5D (TENT5D), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TENT5D (169966)
Length:
4830
CDS:
485..1654

Additional Resources:

NCBI RefSeq record:
XM_024452344.1
NBCI Gene record:
TENT5D (169966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168059 CTTTCGTGGATCAAATGGTAT pLKO.1 1627 CDS 100% 4.950 6.930 N TENT5D n/a
2 TRCN0000418380 ATCAGCCTGCTCCGTACTTTG pLKO_005 1530 CDS 100% 10.800 8.640 N TENT5D n/a
3 TRCN0000167928 CTGGATCAAGTGTTAGATGAA pLKO.1 533 CDS 100% 4.950 3.960 N TENT5D n/a
4 TRCN0000418439 ACGTTATTGACTAGCTATAAT pLKO_005 1871 3UTR 100% 15.000 10.500 N TENT5D n/a
5 TRCN0000424179 ATAAGGATCTGGACGTTATTT pLKO_005 723 CDS 100% 15.000 10.500 N TENT5D n/a
6 TRCN0000413467 CAATTAAGCCATCATAGTAAA pLKO_005 1811 3UTR 100% 13.200 9.240 N TENT5D n/a
7 TRCN0000424035 GCCTGCATCTTTGACTATAAC pLKO_005 1984 3UTR 100% 13.200 9.240 N TENT5D n/a
8 TRCN0000168222 CCAGTTATAGACTGTGCTTAT pLKO.1 3021 3UTR 100% 10.800 7.560 N TENT5D n/a
9 TRCN0000167831 GCAACCATAGAAACTTTGATT pLKO.1 1666 3UTR 100% 5.625 3.938 N TENT5D n/a
10 TRCN0000168189 CCTTTCAAATAACACTGGGAA pLKO.1 928 CDS 100% 2.640 1.848 N TENT5D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452344.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14423 pDONR223 100% 99.6% 98.7% None (many diffs) n/a
2 ccsbBroad304_14423 pLX_304 0% 99.6% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000470523 GATCGAGGCGAACCATGAATCAGC pLX_317 11.6% 99.6% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV