Transcript: Human XM_024452371.1

PREDICTED: Homo sapiens DDB1 and CUL4 associated factor 8 like 2 (DCAF8L2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCAF8L2 (347442)
Length:
3883
CDS:
844..2739

Additional Resources:

NCBI RefSeq record:
XM_024452371.1
NBCI Gene record:
DCAF8L2 (347442)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246265 ACCACAGTCAAAGGTGTTAAT pLKO_005 2251 CDS 100% 13.200 18.480 N DCAF8L2 n/a
2 TRCN0000246263 GGGTTAAAGAAGGTGATTAAG pLKO_005 2497 CDS 100% 13.200 9.240 N DCAF8L2 n/a
3 TRCN0000246262 TCCCGCCAATACCTACCAATT pLKO_005 1968 CDS 100% 10.800 7.560 N DCAF8L2 n/a
4 TRCN0000246264 GGGAGCAGAGAAGGTACAATA pLKO_005 2371 CDS 100% 13.200 7.920 N DCAF8L2 n/a
5 TRCN0000246261 AGTAGCGGTGATGACCTAAAG pLKO_005 1576 CDS 100% 10.800 6.480 N DCAF8L2 n/a
6 TRCN0000122739 CCACCTAAGTACACTGGACTT pLKO.1 2767 3UTR 100% 4.050 2.025 Y DCAF8L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13612 pDONR223 100% 99.5% 99.5% None 388_396delGAGGAGGAG n/a
2 ccsbBroad304_13612 pLX_304 0% 99.5% 99.5% V5 388_396delGAGGAGGAG n/a
3 TRCN0000475832 TATTACTTCGTAATCTGTCTCGCA pLX_317 20% 99.5% 99.5% V5 388_396delGAGGAGGAG n/a
Download CSV