Transcript: Human XM_024452386.1

PREDICTED: Homo sapiens ATPase plasma membrane Ca2+ transporting 3 (ATP2B3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP2B3 (492)
Length:
6850
CDS:
445..3924

Additional Resources:

NCBI RefSeq record:
XM_024452386.1
NBCI Gene record:
ATP2B3 (492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043146 CCGGAAGACAAGCTTTACAAA pLKO.1 2098 CDS 100% 5.625 7.875 N ATP2B3 n/a
2 TRCN0000043143 GCAGGTATAATTGGAGCATTT pLKO.1 5165 3UTR 100% 10.800 7.560 N ATP2B3 n/a
3 TRCN0000043144 GCCTCAGAGATCCTCTTGAAA pLKO.1 2203 CDS 100% 5.625 3.938 N ATP2B3 n/a
4 TRCN0000043147 CCTGGTCCTCTACTTTGTGAT pLKO.1 1557 CDS 100% 4.950 3.465 N ATP2B3 n/a
5 TRCN0000043145 CCAGAATCCAAGACCTCCATT pLKO.1 3950 3UTR 100% 4.950 2.970 N ATP2B3 n/a
6 TRCN0000420416 GTAACGTCTATGACAGCATAT pLKO_005 2930 CDS 100% 10.800 6.480 N Atp2b2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13817 pDONR223 100% 73.2% 73.2% None (many diffs) n/a
2 ccsbBroad304_13817 pLX_304 0% 73.2% 73.2% V5 (many diffs) n/a
Download CSV