Transcript: Human XM_024452467.1

PREDICTED: Homo sapiens O-linked N-acetylglucosamine (GlcNAc) transferase (OGT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OGT (8473)
Length:
5186
CDS:
1139..3136

Additional Resources:

NCBI RefSeq record:
XM_024452467.1
NBCI Gene record:
OGT (8473)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035068 CCATTATTGTAACCACCCGTT pLKO.1 2472 CDS 100% 2.160 3.024 N OGT n/a
2 TRCN0000110398 CCTCTGTTCAACACCAAACAA pLKO.1 3008 CDS 100% 5.625 4.500 N Ogt n/a
3 TRCN0000332591 CCTCTGTTCAACACCAAACAA pLKO_005 3008 CDS 100% 5.625 4.500 N Ogt n/a
4 TRCN0000035067 GCTGAGCAGTATTCCGAGAAA pLKO.1 2060 CDS 100% 4.950 3.960 N OGT n/a
5 TRCN0000286200 GCTGAGCAGTATTCCGAGAAA pLKO_005 2060 CDS 100% 4.950 3.960 N OGT n/a
6 TRCN0000298541 TGTTGCAGATGGGTGATATAT pLKO_005 3236 3UTR 100% 15.000 10.500 N OGT n/a
7 TRCN0000293652 TTTAGCACTCTGGCAATTAAA pLKO_005 420 5UTR 100% 15.000 10.500 N OGT n/a
8 TRCN0000035066 CCAAACTTTCTGGATGCTTAT pLKO.1 855 5UTR 100% 10.800 7.560 N OGT n/a
9 TRCN0000286201 CCAAACTTTCTGGATGCTTAT pLKO_005 855 5UTR 100% 10.800 7.560 N OGT n/a
10 TRCN0000035065 GCCAATCATTTCATTGATCTT pLKO.1 1820 CDS 100% 4.950 3.465 N OGT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467726 CGACGCTTGCAGTCTCACCATATG pLX_317 13.7% 64.1% .7% V5 (not translated due to prior stop codon) 0_1ins1115;1436T>C n/a
Download CSV