Transcript: Human XM_024452674.1

PREDICTED: Homo sapiens putative protein FAM90A15P (LOC112268395), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC112268395 (112268395)
Length:
2558
CDS:
830..1777

Additional Resources:

NCBI RefSeq record:
XM_024452674.1
NBCI Gene record:
LOC112268395 (112268395)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269244 ACTTCCGCTGGGACGTCAATA pLKO_005 2073 3UTR 100% 13.200 6.600 Y FAM90A7P n/a
2 TRCN0000269246 CGGTCCACACAACCAGTAAGA pLKO_005 834 CDS 100% 4.950 2.475 Y FAM90A7P n/a
3 TRCN0000146372 CTCATTTCACTCTCCTGAGAA pLKO.1 1618 CDS 100% 4.950 2.475 Y FAM90A1 n/a
4 TRCN0000149663 GATCCACGGAATCTTCTGATT pLKO.1 122 5UTR 100% 4.950 2.475 Y FAM90A1 n/a
5 TRCN0000150084 CGGAATCTTCTGATTATCTGA pLKO.1 128 5UTR 100% 3.000 1.500 Y FAM90A1 n/a
6 TRCN0000129353 CCTCATTTCACTCTCCTGAGA pLKO.1 1617 CDS 100% 2.640 1.320 Y FAM90A1 n/a
7 TRCN0000417465 AGCCTCTCAGAGTGCTCTTTC pLKO_005 1551 CDS 100% 10.800 5.400 Y FAM90A1 n/a
8 TRCN0000269247 TCCTCAGAGGACAGCGATTCT pLKO_005 1745 CDS 100% 4.950 2.475 Y FAM90A7P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452674.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08474 pDONR223 100% 65.3% 62.9% None (many diffs) n/a
2 ccsbBroad304_08474 pLX_304 0% 65.3% 62.9% V5 (many diffs) n/a
3 TRCN0000479550 ATCACGGATCGCGCTCTGGTGTGC pLX_317 24.5% 65.3% 62.9% V5 (many diffs) n/a
Download CSV