Transcript: Human XM_024452707.1

PREDICTED: Homo sapiens mitochondrial transcription termination factor 4 (MTERF4), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTERF4 (130916)
Length:
896
CDS:
39..863

Additional Resources:

NCBI RefSeq record:
XM_024452707.1
NBCI Gene record:
MTERF4 (130916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431431 ATCTTGTGTTAGATCCAATAA pLKO_005 203 CDS 100% 13.200 10.560 N MTERF4 n/a
2 TRCN0000166991 CTGGACATCATTTCAGAATTT pLKO.1 411 CDS 100% 13.200 10.560 N MTERF4 n/a
3 TRCN0000430550 GTTTCAGCAATGCCCATATTA pLKO_005 346 CDS 100% 15.000 10.500 N MTERF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452707.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481459 GGGCGTGAGATAAAAGTGTAAAAT pLX_317 38.4% 64.1% 44.6% V5 (many diffs) n/a
2 ccsbBroadEn_15243 pDONR223 95.3% 62.1% 43.3% None (many diffs) n/a
3 ccsbBroad304_15243 pLX_304 0% 62.1% 43.3% V5 (many diffs) n/a
Download CSV