Transcript: Human XM_024452715.1

PREDICTED: Homo sapiens catenin alpha 2 (CTNNA2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTNNA2 (1496)
Length:
4172
CDS:
399..3260

Additional Resources:

NCBI RefSeq record:
XM_024452715.1
NBCI Gene record:
CTNNA2 (1496)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452715.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435394 GTTCGCATTGGCGCAATATTT pLKO_005 3519 3UTR 100% 15.000 21.000 N CTNNA2 n/a
2 TRCN0000420427 TACACGGCCTCTCAAGCATTT pLKO_005 1059 CDS 100% 10.800 15.120 N CTNNA2 n/a
3 TRCN0000437769 TGACCCTTGCTCGTCGGTAAA pLKO_005 734 CDS 100% 10.800 15.120 N CTNNA2 n/a
4 TRCN0000421543 TGTACTAGCCAATACGCTTAA pLKO_005 3699 3UTR 100% 10.800 15.120 N CTNNA2 n/a
5 TRCN0000147074 CAACCGAGATTATGTGTTCAA pLKO.1 1112 CDS 100% 4.950 6.930 N CTNNA2 n/a
6 TRCN0000412374 TAAGATGAGATGAGATCAATA pLKO_005 3399 3UTR 100% 13.200 9.240 N CTNNA2 n/a
7 TRCN0000148903 CCAGAAGAACTAGAGGATGAT pLKO.1 2295 CDS 100% 4.950 3.465 N CTNNA2 n/a
8 TRCN0000147992 GAGGTAGATTGTGATGTCATA pLKO.1 2862 CDS 100% 4.950 3.465 N CTNNA2 n/a
9 TRCN0000150270 GAAACCAATGTTCCTTTGCTA pLKO.1 1578 CDS 100% 3.000 2.100 N CTNNA2 n/a
10 TRCN0000149367 GCTACAAATGAGCAAGACCTT pLKO.1 894 CDS 100% 2.640 1.848 N CTNNA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452715.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06063 pDONR223 100% 94.9% 94.9% None 1932G>A;2430_2573del n/a
2 ccsbBroad304_06063 pLX_304 0% 94.9% 94.9% V5 1932G>A;2430_2573del n/a
Download CSV