Transcript: Human XM_024452752.1

PREDICTED: Homo sapiens chitinase 3 like 2 (CHI3L2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHI3L2 (1117)
Length:
1585
CDS:
187..1359

Additional Resources:

NCBI RefSeq record:
XM_024452752.1
NBCI Gene record:
CHI3L2 (1117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371787 GGCTCCCTGTGAAGGATTAAC pLKO_005 1348 CDS 100% 13.200 18.480 N CHI3L2 n/a
2 TRCN0000371786 TATGCTCTCATCTCATCTATT pLKO_005 350 CDS 100% 13.200 10.560 N CHI3L2 n/a
3 TRCN0000377757 TCAGGCTTCCTGGCCTATTAT pLKO_005 1081 CDS 100% 15.000 10.500 N CHI3L2 n/a
4 TRCN0000050014 CCTGTTTCTGAGGAACCATAA pLKO.1 573 CDS 100% 10.800 7.560 N CHI3L2 n/a
5 TRCN0000050015 GAGACCAAGGTTCAGTTCTTA pLKO.1 1213 CDS 100% 5.625 3.938 N CHI3L2 n/a
6 TRCN0000050016 CACCAAGGAAAGGCTTCTCTT pLKO.1 705 CDS 100% 4.950 3.465 N CHI3L2 n/a
7 TRCN0000050017 CAGACCATCAACAGTCTCAAA pLKO.1 433 CDS 100% 4.950 3.465 N CHI3L2 n/a
8 TRCN0000050013 GCTCCTACTACAATGTGGAAT pLKO.1 905 CDS 100% 4.950 3.465 N CHI3L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452752.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05993 pDONR223 100% 99.9% 99.7% None 545C>T n/a
2 ccsbBroad304_05993 pLX_304 0% 99.9% 99.7% V5 545C>T n/a
3 TRCN0000466925 GGTTCACAGTTTTTGAACTCAACC pLX_317 35.8% 99.9% 99.7% V5 545C>T n/a
Download CSV