Transcript: Human XM_024452778.1

PREDICTED: Homo sapiens ALK receptor tyrosine kinase (ALK), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALK (238)
Length:
4417
CDS:
170..2185

Additional Resources:

NCBI RefSeq record:
XM_024452778.1
NBCI Gene record:
ALK (238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196366 GTATACTTCCTTATGCTTCTT pLKO.1 2461 3UTR 100% 4.950 3.960 N ALK n/a
2 TRCN0000199879 GCCCTGATCATCAGCAAATTC pLKO.1 824 CDS 100% 13.200 9.240 N ALK n/a
3 TRCN0000426445 TCACAAACCAGAGACCAAATG pLKO_005 2257 3UTR 100% 10.800 7.560 N ALK n/a
4 TRCN0000431959 TGAGCATGGGTTCATCCTATT pLKO_005 2355 3UTR 100% 10.800 7.560 N ALK n/a
5 TRCN0000426979 TGTGCCATGCTGCCAGTTAAG pLKO_005 1184 CDS 100% 10.800 7.560 N ALK n/a
6 TRCN0000427215 CTCTTCCTTGGGATCCCTAAG pLKO_005 2206 3UTR 100% 6.000 4.200 N ALK n/a
7 TRCN0000199017 CTTCGCTGACTGCCAATATGA pLKO.1 2001 CDS 100% 5.625 3.938 N ALK n/a
8 TRCN0000000785 GAGCTGGTCATTACGAGGATA pLKO.1 2121 CDS 100% 4.950 3.465 N ALK n/a
9 TRCN0000000784 GTGATAAATACAAGGCCCAGA pLKO.1 2407 3UTR 100% 2.160 1.512 N ALK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452778.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14540 pDONR223 0% 41.4% 41.4% None 0_1ins2847 n/a
2 ccsbBroad304_14540 pLX_304 0% 41.4% 41.4% V5 0_1ins2847 n/a
3 TRCN0000469859 GAGCGTGGTCCCCGGCAGTTAAGG pLX_317 8.4% 41.4% 41.4% V5 0_1ins2847 n/a
Download CSV