Transcript: Human XM_024452783.1

PREDICTED: Homo sapiens glutamate decarboxylase 1 (GAD1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAD1 (2571)
Length:
2778
CDS:
493..1509

Additional Resources:

NCBI RefSeq record:
XM_024452783.1
NBCI Gene record:
GAD1 (2571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078468 CGCCATAAACTCAACGGCATA pLKO.1 883 CDS 100% 4.050 5.670 N GAD1 n/a
2 TRCN0000078472 CAACCAGATGTGTGCAGGATA pLKO.1 1005 CDS 100% 4.950 3.465 N GAD1 n/a
3 TRCN0000078469 GCACGACTGTTTATGGAGCTT pLKO.1 761 CDS 100% 2.640 1.848 N GAD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00609 pDONR223 100% 56.9% 56.9% None 0_1ins768 n/a
2 ccsbBroad304_00609 pLX_304 0% 56.9% 56.9% V5 0_1ins768 n/a
3 TRCN0000467890 CACATGTACAGATACATGGTTATT pLX_317 25.4% 56.9% 56.9% V5 0_1ins768 n/a
4 ccsbBroadEn_06248 pDONR223 100% 56.8% 56.7% None 0_1ins768;104A>G n/a
5 ccsbBroad304_06248 pLX_304 0% 56.8% 56.7% V5 0_1ins768;104A>G n/a
6 TRCN0000479088 GTCCCTGGAGGACGGGATCCCCTT pLX_317 20.2% 56.8% 56.7% V5 0_1ins768;104A>G n/a
Download CSV