Transcript: Human XM_024452976.1

PREDICTED: Homo sapiens threonine synthase like 2 (THNSL2), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THNSL2 (55258)
Length:
1669
CDS:
333..1013

Additional Resources:

NCBI RefSeq record:
XM_024452976.1
NBCI Gene record:
THNSL2 (55258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162973 GAGCCGATCAAGACTGTGTTT pLKO.1 456 CDS 100% 4.950 6.930 N THNSL2 n/a
2 TRCN0000120103 GCTGCCATTGAGAGTGTTCAA pLKO.1 300 5UTR 100% 4.950 6.930 N Thnsl2 n/a
3 TRCN0000163103 GCTGCCATTGAGAGTGTTCAA pLKO.1 300 5UTR 100% 4.950 6.930 N THNSL2 n/a
4 TRCN0000163285 GACAACTGGATGCTGATGCTT pLKO.1 1078 3UTR 100% 3.000 2.400 N THNSL2 n/a
5 TRCN0000161397 GCTGTTAAATCAACCTTGGCA pLKO.1 771 CDS 100% 0.750 0.600 N THNSL2 n/a
6 TRCN0000160764 CAAAGGTCACTGCACAAAGAT pLKO.1 356 CDS 100% 5.625 3.938 N THNSL2 n/a
7 TRCN0000161914 GTCTGAGCTGTAGTGAAAGTT pLKO.1 1406 3UTR 100% 5.625 3.938 N THNSL2 n/a
8 TRCN0000160730 CACAATCTGATGAGCCTGAAT pLKO.1 501 CDS 100% 4.950 3.465 N THNSL2 n/a
9 TRCN0000163657 GAAAGTTTCAGGGCCTGCAAA pLKO.1 1420 3UTR 100% 4.950 3.465 N THNSL2 n/a
10 TRCN0000163783 GCACAATCTGATGAGCCTGAA pLKO.1 500 CDS 100% 4.050 2.835 N THNSL2 n/a
11 TRCN0000160470 CTGTTAAATCAACCTTGGCAT pLKO.1 772 CDS 100% 2.640 1.848 N THNSL2 n/a
12 TRCN0000163039 GAGCAGTTTGAAAGGACCCAA pLKO.1 882 CDS 100% 2.640 1.848 N THNSL2 n/a
13 TRCN0000162816 CCAAAGTGTGAATCTGCCCAA pLKO.1 899 CDS 100% 2.160 1.512 N THNSL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.