Transcript: Human XM_024453021.1

PREDICTED: Homo sapiens HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 (HECW2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HECW2 (57520)
Length:
11919
CDS:
285..5024

Additional Resources:

NCBI RefSeq record:
XM_024453021.1
NBCI Gene record:
HECW2 (57520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004790 CCAGGGAAGTTAAAGTTAATT pLKO.1 3942 CDS 100% 15.000 10.500 N HECW2 n/a
2 TRCN0000004791 GCACAATACTTGGAGTCAATT pLKO.1 1312 CDS 100% 13.200 9.240 N HECW2 n/a
3 TRCN0000004793 CCCTTATCTTAAGATGTCAAT pLKO.1 902 CDS 100% 4.950 3.465 N HECW2 n/a
4 TRCN0000004789 GCCCAAACATTTCTTTGAGAT pLKO.1 6671 3UTR 100% 4.950 3.465 N HECW2 n/a
5 TRCN0000086876 CCTCATTATCTTCTGGGACAT pLKO.1 509 CDS 100% 4.050 2.835 N Hecw2 n/a
6 TRCN0000086874 GTTCTTCAATCCTGACCCTTA pLKO.1 887 CDS 100% 4.050 2.835 N Hecw2 n/a
7 TRCN0000004792 GCTTACAATGACAAGATTGTT pLKO.1 3543 CDS 100% 0.563 0.394 N HECW2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453021.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.